Sunday, January 27, 2008

The rise of "Berber" speaking or Imazighen populations

ca. 8ky ago or so takes us back to the lifetime of TMRCA of proto-Tamazight/'Berber' speakers, the ancestors of contemporary Tamazight/'Berber' speakers.

Language differentiation of proto-Afrasan in Eastern Sahara-Sahel: These could have diverged into sub-branches of non-tonal proto-languages, which proceeded to expand northward, westward and south-eastward intra-continentally, while the north-eastward expansions culminated into the flow [of one at least] of these non-tonal proto-sub-languages, amongst other cultural elements, into the Levant to evolve into the Semitic languages of those regions. These would likely have been mainly E-M78 carriers. It is also possible that more than a single non-tonal proto-language branch made its way into the 'near East', i.e. possibly a few very closely related dialects making their way there [and not necessarily all at once], whereby they would have fused with one another to produce one or other several more Semitic languages, with fusions and fissions occurring over the course of history as groups interacted and others moved into new locations. Of course, some continued to develop throughout history ultimately into the languages as we know them today, while others likely became defunct at some point, even though they would have still shared common features with the surviving variety of today. Same thing could have happened intra-continentally, pending specific evidential corroboration to that extent. Apparently, other E-M35 lineages also made their way to “southwest Asia”, likely as far back, if not relatively little earlier than M78 derivatives [if Semino et al.’s 2004 chart is any indication], as evidenced by the Hg E-M123 across the Red Sea outside of Africa. What these people spoke when they reached “southwest Asia”, is anyone’s guess; it could likely have been some non-tonal sub-branch which, as the present author has said here before, mixed or what have you due to various demographic events of the region—just personal conjecture. These could have crossed at any point along the Red Sea, possibly even from sub-Saharan East Africa.

The tonal sub-branches of the differentiated parent proto-Afrasan language proceeded largely westward and south-eastward. Again, over the course of time, at some point in history, it is possible that some tonal proto-sub-branches became defunct or fused with one or several others to produce newer dialects, again—also not ruling out fusions and fissions of sub-branches as a product of interaction within proximity and movement to new locations ; just conjecture on the present author's part.

It goes without saying, that the above differentiation of proto-Afrasan basal language would not have been a single event, but a process [series of processes] which would have culminated in branching off at various points in time, and further differentiations within the Afrasan languages [i.e. in the sub-branches] would have been progressive as well, not single events.

Anyway, as far as proto-Tamazight speakers go:
If we are to keep in mind the above mentioned language “nature” and divergence of the Afrasan groups [with the help of insights from linguists like Ehret], along with lineage expansions, as observed by the likes of Underhill, Luis et al. [“Nile Valley vs. the African Horn”] and Arredi et al. (2004), not to mention Cruciani’s latest ‘re-organization’ attempts, then it would appear that the ancestors of the Tamazight/“Berber” groups diverged from within the general vicinity of between Egypt and Sudan expanse, or in the southern bound of the western [although the eastern desert cannot be ruled out in the assessment] desert of Egypt ca. 8ky ago or so, and thence moved northward, while others moved westward in the Saharan-Sahelian belts shortly after. By ca. 3ky ago sections of these earlier “Berber” populations would have expanded westward, culminating in considerable expansions in the westernmost coastal North African regions by 2ky ago or so [Luis et al. 2004], resulting from what became a 'founder effect' in that region.

Throughout prehistory and history, some of these more mobile Tamazight/“Berber” groups, like those in the Sahel and the Sahara, may have moved back and forth, i.e. from the north back to the Saharan regions and vice versa. For instance, it isn’t surprising that Saharan/Sahelian Tamazight/“Berber” groups like the Sanhaja closely resemble sections of northern coastal-based groups like the Kesra of Tunisia, and indeed, the Sahelian Tamzight/“Berber” groups have a history of setting up socio-cultural complexes or “empires” in coastal North Africa by way of conquests. It would appear that the Tamazight/“Berber” groups likely diverged from the same populations ancestral to the contemporary Bedawi in the Red Hills regions of Sudan [e.g. see above: Underhill for indicators].

The Beja language, which is viewed by some linguists to be a somewhat distant relative of Cushitic languages, is perceived to be relatively closer to the non-tonal Egyptic, and other [generally perceived] younger non-tonal branches of “Berber” and “Semitic” than the largely tonal Afrasan groups in sub-Saharan east Africa. The Chadic branches, which are perceived to be largely tonal, undoubtedly have some level of closeness with Tamazight/“Berber” languages given the proximity and interactions of these groups in the Saharan-Sahel regions…just as Ethio-semitic languages have some level of closeness with the Cushitic languages therein due to years of interaction and cohabitation.

According to Underhill, E-M81 appears in samples from Sudan, wherein it occurred in two individuals who happened to be of Beja extraction...

Apparently, Arredi et al. (2204) also took note of this finding, as relayed by Underhill:

Second, just two haplogroups predominate within North Africa, together making up almost two-thirds of the male lineages: E3b2 and J* (42% and 20%, respectively). E3b2 is rare outside North Africa (Cruciani et al. 2004; Semino et al. 2004 and references therein), and is otherwise known only from Mali, Niger, and Sudan to the immediate south, and the Near East and Southern Europe at very low frequencies....

The M35 lineage (see the phylogeny in fig. 1A for marker locations) is thought to have arisen in East Africa, on the basis of its high frequency and diversity there (Cruciani et al. 2004; Semino et al. 2004), and to have given rise to M81 in North Africa. The TMRCA....E3b2 (2.8-8.2 KY) should thus bracket the spread of E3b2 in North Africa.....Thus, although Moroccan Y lineages were interpreted as having a predominantly Upper Paleolithic origin from East Africa (Bosch et al. 2001), according to our TMRCA estimates, no populations within the North African samples analyzed here have a substantial Paleolithic contribution.....In addition, genetic evidence shows that E3b2 is rare in the Middle East (Semino et al. 2004), making the Arabs an unlikely source for this frequent North African lineage. — Arredi et al., A Predominantly Neolithic Origin for Y-Chromosomal DNA Variation in North Africa
SNP Haplogroup Frequencies in the Five North African Population Samples and Other Published Samples: http://www.journals.uchicago.edu/AJHG/journal/issues/v75n2/41184/41184.html


Those regions accompanied by Sudan above, in particular those in "Near East" and "Southern Europe", are largely areas where Imazighen (Berbers) groups have historically emigrated to. However, since I'm not aware of any notable Imazighen (Berber) presence in Sudan, although the Siwa "Berbers" do reside in the northwestern desert of Egypt, E-M81 detection therein, must be a relic of groups ancestral to the aboriginal Imazighen populations [who have become more or less modified to varying degrees, by gene flow with neighboring non-Imazighen populations, whether it is in the Sahara and Sahel, or right across the Mediterranean Sea], who generally happen to be genealogically tied by the aforementioned E-M81 marker — hence, its nickname as a "characteristic Berber" marker.

L1, L2 & L3 haplogroups: mtDNA Analysis of Nile River Valley Populations

These studies may perhaps be forgiven for their shortcomings, when considering the dates of publication and the extant knowledge [in the field in question] at the time of publication. Nonetheless, for those who might be in the little know, a few things needed to be straightened out:

C. Fox, 1997:

mtDNA analysis in ancient Nubians supports the existence of gene flow between sub-Sahara and North Africa in the Nile valley

Abstract:

The Hpal (np3,592) mitochondrial DNA marker is a selectively neutral mutation that is very common in sub-Saharan Africa and is almost absent in North African and European populations. It has been screened in a Meroitic sample from ancient Nubia through PCR amplification and posterior enzyme digestion, to evaluate the sub-Saharan genetic influences in this population. From 29 individuals analysed, only 15 yield positive amplifications, four of them (26·7%) displaying the sub-Saharan African marker. Hpa I (np3,592) marker is present in the sub-Saharan populations at a frequency of 68·7 on average. Thus, the frequency of genes from this area in the Merotic Nubian population can be estimated at around 39% (with a confidence interval from 22% to 55%). The frequency obtained fits in a south-north decreasing gradient of Hpa I (np3,592) along the African continent. Results suggest that morphological changes observed historically in the Nubian populations are more likely to be due to the existence of south-north gene flow through the Nile Valley than to in-situ evolution.

Krings et al study, 1999:

mtDNA Analysis of Nile River Valley Populations: A Genetic Corridor or aBarrier to Migration?

To assess the extent to which the Nile River Valley has been a corridor for human migrations between Egypt and sub-Saharan Africa, we analyzed mtDNA variation in 224 individuals from various locations along the river. Sequences of the first hypervariable segment (HV1) of the mtDNA control region and a polymorphic HpaI site at position 3592 allowed us to designate each mtDNA as being of "northern" or "southern" affiliation. Proportions of northern and southern mtDNA differed significantly between Egypt, Nubia, and the southern Sudan. At slowly evolving sites within HV1, northern-mtDNA diversity was highest in Egypt and lowest in the southern Sudan, and southern-mtDNA diversity was highest in the southern Sudan and lowest in Egypt, indicating that migrations had occurred bidirectionally along the Nile River Valley. Egypt and Nubia have low and similar amounts of divergence for both mtDNA types, which is consistent with historical evidence for long-term interactions between Egypt and Nubia. Spatial autocorrelation analysis demonstrates a smooth gradient of decreasing genetic similarity of mtDNA types as geographic distance between sampling localities increases, strongly suggesting gene flow along the Nile, with no evident barriers. We conclude that these migrations probably occurred within the past few hundred to few thousand years and that the migration from north to south was either earlier or lesser in the extent of gene flow than the migration from south to north.

A Response to C. Fox and Krings et al.

The authors rely on just the hypervariable region, which as they acknowledge is known to be limited on the very probable potential of harboring "parallel mutations", and the absence or presence of the restriction enzyme identified site of HpaI site. They say:

Utilizing three sites in this manner should minimize incorrect classification of mtDNA types; however, because the two sites in HV1 are subject to repeated mutations (Hasegawa et al. 1993), we were concerned that some incorrect classification might nevertheless occur....

Approximately one-third of the Nile River Valley mtDNA types could be unambiguously classified on the basis of this database comparison; the results were nearly completely concordant with the classification based on the three sites, with the single discrepancy involving an Egyptian mtDNA that, on the basis of the three sites, was classified as northern but, on the basis of the database comparison, was classified as southern because it was identical to sequences found in two Songhai from Mali and two Kikuyu from Kenya (Watson et al. 1996). Because alteration of the classification of this one sequence does not significantly change any of the results that follow, this Egyptian mtDNA was still classified as northern, in accordance with the results from use of the three sites.

But what do we know of L3 based lineages, do they all have what the authors call?...

In addition, it has been proposed that the HpaI site at 3592 has a single origin in sub-Saharan Africa

Would M1 for instance have this site detected as positive?

The present author sees the method used herein, almost akin to using RFLP in Y chromosomes and microsatellite motifs, without having details on binary markers that could clearly define the monophyletic units themselves, thereby pooling otherwise different lineages based on absence or presence of certain restriction sites. We've seen this in the case of Y chromosomes, wherein E-M78, E-M81 and some other yet-to-be identified lineage were pooled together based on certain RFLP sequences, but when binary markers were tested, these related but distinct lineages came to the fore. Exclusively relying on three hypervariable segment sites for analysis, has definitely got to be one of the weakest aspects of this study, for reasons just mentioned.

In relation to the questions just asked above, we have:

The main sub-Saharan African haplotypes, thus, are characterized by a combination of 10394DdeI(+)/10397AluI(-)/3592HpaI(+) markers (haplogroup L, comprising the LI and L2 lineages) (Chen et al. 1995, 2000). A less frequent group of haplotypes lacks the African-specific 3592 HpaI marker [10394DdeI(+)/ 10397AluI(-)/3592HpaI(-)] (Chen et al. 1995, 2000) and has been designated as haplogroup L3 (Watson et al. 1997). A minority of African haplotypes (2.3% of Africans) lack all three of these mutations [10394DdeI(-)/10397AluI(-)/ 3592HpalI(-)]. Some align with the European lineage U (Chen et al. 2000), but a number of the mtDNAs belong to branches of the African haplogroup L3, itself derived from African haplogroup L1 (Watson et al 1997). — Clemencia Rodas et al., Mitochondrial DNA studies show asymmetrical Amerindian admixture in Afro-Colombian and Mestizo populations, 2003.

Note that even in the above piece, even though restriction enzyme markers allow for grouping into superphyletic units [in the case of those which were deemed to belong to the L3 supergroup, it isn't even that clear-cut, as there are those which lack all the restriction markers tested, and then there are those which harbor 10394 DdeI (+). L1 and L2 lineages on the other hand, seemed to have been pooled under that which tested positive for 3592 HpaI—as such, without further information, we are hardly told about which ones specifically fall into Hgs L1 and L2 respectively], these alone don't tell us much about the specific designated haplogroups or else subclades actually involved. *Distinct* subclades would have just been pooled under specific restriction enzyme identified sites, pending more information on subclade-specific characteristic or definitive markers.

At this point, the present author doesn't question the African origin of Hg M1, and by extension, the possibility of such for the *basic* characteristic motifs for the M macro-haplogroup; The present author merely brought Hg M1 up, as an example of one of the notable L3 derived lineages in East Africa, extending from the sub-Saharan region to the Northeast end. Hg M1 happens to occur predominantly in Africa. The present author's motive here is to get the reader to start thinking about the L3 lineage—which is just as African in origin as L1 and L2 lineages, but lack the so-called "African-specific" site. So, the fact that the term "African-specific" was used, might mislead someone to think that the other mtDNA lineages under study couldn't have also been African.

Africa Timeline Index: West to East And North to South

ATI One-Stop Timeline Index

The goal here is to compile a chronology of developments across continental Africa.

...but for starters:

Back-to-back post based on the 2003 compilations of Dr. Susan J. Herlin and Professor Emerita of the Department of History, at the University of Louisville—USA, but with UPDATE inserts [as designated by Italicized pieces, including statements proceeded by "*"] by myself, to add relative precision to what would have well ended up being a relatively outmoded compilation as a result of the more recent revelations. The present author of this blog is sure there will still be much room for further precision even after these initial ‘personal’ insertions, much of which will be undertaken as this blog topic gets updated; in the meantime…

CHRONOLOGY OF ANCIENT WEST AFRICA

From 30,600 to 10,000 BC: "A cultural flow, from the southeast of Subsaharan Africa and to the Sahara, could explain the diffusion of the microlithic industries all the way through West Africa. We observe them initially in Cameroon at Shum Laka (30.600-29.000 BC), then at the Ivory Coast in Bingerville (14.100-13.400 BC), in Nigeria in Iwo Eleru (11.460-11.050 BC), and finally in Ounjougou (phase 1, 10th millennium BC)." [see: Human population and paleoenvironment in West Africa]

23,000 BP ~ 21,050 BC: "After a favourable climatic period, characterised by relatively dense and diversified Palaeolithic occupations, the arid Ogolian begins locally around 23000 years BP and is represented at Ounjougou by a significant depositional and archaeological hiatus." [see: Aziz Ballouche]

*Some time at more or less 18.8ky ago, E3a carriers trace their common recent ancestor back to this period [see: Semino et al, 2004]. In the meantime, if Goncalves et al.'s words are any indicators to go by, E-M33 (E1) carriers, also ancestral to contemporary West Africans, were likely already in Western regions of what is now desiccated Sahara and which now grades into Sahel-sub-Saharan region, possibly amongst groups of older lineages like B (M60) and perhaps to a lesser degree A (M91), prior to the arrival or any significant presence of E3a carriers in west Africa originating eastward...

The prescence in Portugal of both the A and E1 haplogroups may be independent from the slave trade (otherwise E3a would be well represented since it comprises the majority of West African lineages). These findings either suggest a pre-neolithic migration from North Africa or a more recent origin from a founder population of small size that did not carry haplogroup E3a, which is a major component in North African populations today. TMRCA for Portuguese E1 lineages estimated as 22.9 +/- 7.2 ky favors the first scenario..." — Goncalves et al

After 12,000 BCE ~ 14ky ago: Beginning of a wetter phase in Africa north of the equator. Populations ancestral to most West Africans make up the foragers and hunters of these lands.

10th millennium BC ~ 12ky ago: At Ounjougou - "It is not until the Holocene and the return of humid climatic conditions, beginning in the 10th millennium BC, that it is possible to again observe evidence of human occupation." [see: Aziz Ballouche]

"Consequently, it has to be seen in the context of heavy rainfalls and a resettlement of the vegetation cover, during the 10th millennium BC, that a new population arrives on the Plateau of Bandiagara." [see: Human population and paleoenvironment in West Africa]

Between 10th and 9th millennia BC: "Some charcoal are present at the transition between the 10th and 9th millennia BC, but it is currently impossible to determine if it is of anthropic origin or natural." [see: Aziz Ballouche]

The 10,000 and 9,000 BC (Phase 1 of the Holocene in Ounjougou): "The first sedimentary sequence of the Holocene can be observed at the Ravin de la Mouche. It's a channel dug into yellow Pleistocene silt and filled with coarse grained sand and pebbles. As a chronological reference for the upper levels of this early Holocene site, we hold ten radiocarbon dates between 9400 and 8400 BC cal. The associated lithic industry evidences predominantly a unidirectional mode of debitage. But also other technologies, such as bipolar on anvil or multidirectional, have been applied by the Early Holocene population. The raw material mainly used was quartz. The typological range consists of small retouched flakes, geometric microliths and perçoirs, but also of continuously retouched bifacial arrowheads and backed points." [see: Human population and paleoenvironment in West Africa]

ca. 11,000 BP: Archeological indicators of Yam cultivation in west Africa in the vicinity of the Niger delta region. [Specific notes on this will follow shortly]

"By" 11,000 years BP ~ by 9050 BC:

"The age of the sediment in which they were found suggests that the six ceramic fragments discovered between 2002 and 2005 are at least 11,400 years old. Most ancient ceramics from the Middle East and the central and eastern Sahara regions are 10,000 and between 9-10,000 years old, respectively." [see: Human population and paleoenvironment in West Africa]

By the 'beginning' of 8,000 BC: "Outstandingly, there has been evidence of the presence of pottery and seed grinding implements since at least the beginning of the 8th millennium BC. It is therefore the oldest site. The eighth millennium (Phase 2 of the Holocene in Ounjougou) known of this socio-economic type in sub-Saharan Africa...

The pottery and the seed grinding implements of phase 2 of Ounjougou are the oldest artefacts of this type known at present in sub-Saharan Africa. To current knowledge, the pottery of Ounjougou could either have been invented in the actual Sudano-Sahelian zone or been imported from the Central Sahara, where there has been evidence since the ninth millennium BC. Still, the oldest pottery known in the Sahara, from the site of Tagalagal in Niger, is already quite diversified at the moment of its appearance, possibly meaning that the technique has been introduced.

The lithic industry of the phases 1 and 2 on the other hand shows similarities to both more southern and Saharan industries. Quartz microliths, obtained through bipolar debitage on anvil, are a characteristic of the West African techno-complex according to Kevin MacDonald. Bifacially retouched arrowheads, in contrast, are specific for Saharan production."
[see: Human population and paleoenvironment in West Africa]

"The eighth millennium (Phase 2 of the Holocene in Ounjougou): The subsequent Holocene sequence is well documented by two principal sites, the Ravin du Hibou and Damatoumou. The archaeological levels can be quite clearly chronologically placed by means of a date obtained through OSL measurements (9420±410 Ka) and seven radiocarbon dates (between 8000 and 7000 BC cal). The lithic industry, exclusively quartz, is characterised by unidirectional, bidirectional and peripheral debitage, as well as by bipolar on anvil. There are essentially microlithic tools: perçoirs, backed points, notched pieces, denticulates, scrapers, retouched flakes and geometric microliths. Some small bifacially retouched arrowheads were also found on those sites. At the Ravin du Hibou, seven sherds have been found during excavation. They are heavily fragmented and thus preventing the reconstruction of the form of the vessels. Quartz has always been used as a temper. In just a single case, grog has been used in addition. Two shards show identifiable decorations. Two different techniques have been used: A rolled impression, possibly made with a peigne fileté souple or with a cordelette, and a simple comb impression. There were also seed grinding implements discovered at the Ravin du Hibou, a fragment of a seed grinding stone and a cylindrical upper grinding stone." [see: Human population and paleoenvironment in West Africa]

By about 8,000 BCE: Great lakes formed in Niger Bend, Lake Chad and Upper Nile regions. Spread of 'African aquatic culture' through this 'great lakes' region. Sedentary fishing communities using pottery and microlithic tools become established long the shores of lakes and rivers. Saharan region enjoys savanna-type climate. Favorable conditions lead to population growth.

9,000 to 6,000 BCE: Saharan region in its wettest phases.

By 6,000 BCE: Evidence of domesticated 'humpless' cattle in the Saharan region. Also seed-cropping (or harvesting) of grains.

*ca. 8.2ky ago ~ 6,200 BC [See: Arredi et al. 2004, and also Semino et al. 2004, and Luis et al.; Nile Valley corridor vs. the African Horn]—Proto-Tamazight (Proto-“Berber”) common recent ancestor arose in the vicinity of eastern Sahara-Sahel region, likely in the vicinity of where modern Upper Egypt/Sudan general region lie. [Notes on this will follow shortly - below]

6,000-2,500 BCE: Spread of predominantly cattle-raising peoples throughout the Sahara.
Probably ancestral to modern-day Berber groups.

By the 5,000 BC and 2,000 BC: The bifacially retouched arrowheads are exclusively made of quartzitic sandstone. Typologically, they can be associated to Saharan ones. These are usually very rarely found south of the Sahara, and give evidence of a North/South contact. Two phases can be distinguished: a first around the fifth millennium BC, and a second around the third and second millennium BC. The latter evidence of contact between the Sahara and sub-Saharan West Africa is most likely linked to the beginning of the current arid phase.

The analysis of the tools and debitage waste showed that it was a very specialized workshop. Only bifacially retouched arrowheads were produced. The entire chaîne opératoire could be reconstructed. [see: Human population and paleoenvironment in West Africa]

Between 4000 BC and 1000 BC: At Tichitt-Walata—"Before 2000 BC, what is today the southern Sahara was inhabited by significant numbers of herders and farmers. On the rocky promontories of the Tichitt-Walata (Birou) and Tagant Plateaus in modern day Mauritania, they built what are considered among the earliest known civilizations in western Africa. Composed of more than 400 stone masonry settlements, with clear street layouts, some settlements had massive surrounding walls while others were less fortified. In a deteriorating environment, where arable land and pasturage were at a premium, the population grew and relatively large-scale political organizations emerged - factors which no doubt explain the homogeneity of architecture, settlement patterns, and material culture (e.g., lithic and ceramic traditions). This agro-pastoral society traded in jewelry and semi-precious stones from distant parts of the Sahara and Sahel, while crafts, hunting, and fishing were also important economic pursuits...Their elites built funerary monuments for themselves over a period extending from 4000 to 1000 BC." [sources: see Ray A. Kea, and Mauny, R. (1971), “The Western Sudan” in Shinnie: 66-87. Monteil, Charles (1953), “La Légende du Ouagadou et l’Origine des Soninke” in Mélanges Ethnologiques (Dakar: Bulletin del’Institut Francais del’Afrique Noir)]

by ca. 3,000 BC the Saharan region enters into desiccation.

By 3,000 BC: Evidence of iron working and production in West Africa.

"In fact, only in Africa do you find such a range of practices in the process of direct reduction [a method in which metal is obtained in a single operation without smelting],and metal workers who were so inventive that they could extract iron in furnaces made out of the trunks of banana trees," says Hamady Bocoum, one of the authors. [references: The Origins of Iron Metallurgy in Africa, 2002; "Iron Roads in Africa" project c/o UNESCO]

3,000 to 1,000 BCE: Farming spreads through the former fishing belt of the tropical woodland savannas and forest margins of West Africa. This Guinea Neolithic era saw the domestication of millet, rice, sorghum, yams, and palm trees among others.

From ca. 3,000 BCE: Proto-Bantu speakers having originated in the Nigerian-Cameroon border region expand to the equatorial forests of the Congo region. There were supposedly two streams of this expansion: Presumably the western [and earlier movement] stream and the eastern one.

After 2,500 BCE: Saharan region enters a period of rapid desertification, driving people and larger game animals to seek better watered lands to the north and south for habitation. Neolithic settlements spread along the Saharan borderlands and near rivers and lakes in the West.

1,200 to 700 BCE: Excavations at Dar Tichitt (modern Mauritania) reveal progression from large, un-walled lakeside villages to smaller walled hilltop villages in response to drier climate and increasing pressure from nomads.

By ca. 3ky ago ~ 1st millennium BC : the Tamazight/“Berber” groups who were already inhabiting parts of coastal Northeast Africa, likely in the Siwa region, had moved westward to where modern Libya and Tunisia lie. [Luis et al.: older expansion ages of E-M81 lineages in Egypt compared to that observed in coastal northwest African Tamazight speakers] Movements also from the Tamazight-speaking groups in Saharan region to coastal north Africa during this period should not be ruled out.

After 2,000 BCE: Favorable climatic conditions and developing technology and socio-cultural systems lead to population growth in the Niger valleys. Neolithic farming spreading south and east from the area of modern-day Cameroon. Probably associated with speakers of proto-Bantu languages.

After 500 BCE: Height of the civilization known as Nok, which produced art work ancestral to that of later Yoruba and lgbo peoples.

"By" 250 BC: "The earliest occupants of Jenne-Jeno (c. 250 BC - 50 AD) possessed iron and had a subsistence base that was predominantly aquatic, e.g. waterfowl and fish, although bovids are also found that are possible those of the domestic Bos taurus (McIntosh & McIntosh 1981: 15" - courtesy of Mikey Brass

By 2 to 2.3ky ago ~ ca. 1st cent. BC to 300 BC : Expansion of coastal Northwest African Tamazight/"Berber" speakers in the westernmost region of coastal Northwest Africa occurs. [Morocco/Algerian vicinity][see Luis et al., 2004]

WEST AFRICA: C. 800 BCE TO 1591 AD/CE

By 800 BCE Neolithic agricultural peoples inhabit the best lands of the savanna and forest margins. Regional trade networks based on the exchange of salt, fish, pottery, and other regional specialties developing. Small, clan-based villages typical of agricultural areas. Nomads dominate in the drier areas.

—800 to -500 Development of Carthage in the north stimulates exchanges of products across the Sahara Desert, managed by desert Berbers using horses, oxen and chariots. Iron use spreads into the region from the north or east, or both. Larger scale settlements appearing in southern Mauritania. the middle Niger River basin, and the Jos plateau region. These areas correspond respectively to the probable ancestral homes of the modern Soninke (northern Mande); Songhai; and Yoruba peoples.

—500 to -200 Iron use spreads rapidly throughout West Africa, stimulating population growth, trade, and urbanization. Iron-age peoples of Nok (modern Nigeria) produce magnificent terracotta sculptures stylistically ancestral to later Yoruba and Benin art. Indirect trade continues across increasingly well-marked Saharan trails, still traversed by horse or ox-drawn vehicles.

—200 BC t0 the 2nd A.D. The Ghana/Wagadu Heartland

The historical importance of the Tichitt-Tagant complex and the Mema district derives from the development of the Ghana/Wagadu state organization in the area, probably between the 2nd century BC and the 2nd century A.D. Together with the Hodh and Awkar districts, they formed the kingdom’s heartland for more than a thousand years (see fig 7) (cf. Robert-Chaleix 1989: 264). With a few exceptions, the first millennium A.D. was a time of fairly continuous and political consolidation of the system in its struggles with Kawkaw/Gao formation, on the one hand, and the Anbiya/Sanhaja formation in the WS, on the other.…
- by Ray A. Kea, Department of History, University of California at Riverside, 2004.

—800 to +200 Era of Nok civilization. Bantu expansion 'takes off' to the south and east. Earliest towns, such as Jenne, growing up along the Niger on its most northerly stretch.

—100 to +100 Camel use reaches the western Sahara via Berbers living in its southern reaches.

—c.100 to 400 CE
: Camel using Saharan Berber peoples, such as the Taureg and Sanhaja, develop trans-Saharan trade routes, linking the Maghrib and West Africa directly for the first time. Salt, copper, gold, dates, slaves, agricultural produce, manufactured goods and ivory among the goods exchanged. Soninke-led Ghana, Songhai-led Gao grow as middlemen for the expanding commerce. Trade routes also link Nigeria and Lake Chad to North Africa.

*On a side note: "The historical records of Ghana come from Arab sources dating between 800 and 1650 AD, but Ghana had been in existence for long before then and was centred in the present-day Sahel region of south-eastern Mauritania and western Mali. (Munson 1980: 457)" — courtesy of Mikey Brass

Truth is, Ghanaian complex actual age is still obscure, but by 100 CE it was already in place.

—400 to 900 Ghana, with its capital at Kumbi Saleh, becomes the first regional "great power." With their control over the southern end of the trans-Saharan trade and the northern end of the gold trade, the Ghana of Wagadu can afford the cavalry necessary to enforce his rule throughout the lands between the Niger and the Senegal Rivers. The trans-Saharan boom stimulates the growth of regional trade in copper, iron and other goods, both agricultural and manufactured.

—750 to 1000 Muslim merchants from the North become a major force in trans-Saharan and West African commerce. Islam spreads to Takrur and Ghana. Among the Kanuri of Lake Chad, the Sefawa family founds a dynasty who will rule Kanem for a thousand years. The trans-Saharan trade grows rapidly along with the expansion of the Islamic world. Artists of Igbo Ukwu in southern Nigeria produce fine works in bronze.

—ca.1000 Foundation of Ife, the political and spiritual capital of the Yoruba.

—1054 to 1070 Almoravid Sanhaja establish control over trans-Saharan routes from the borders of Ghana to Morocco, greatly weakening Ghana.

—ca.1085: Almoravids arrive and subsequently take control in the Iberian peninsula, initiating African-Islamic control of the region

—11th & 12th c. Several Sudanic kings convert to Islam. Commerce in the Sudan gradually comes to be dominated by Muslims, both of local and north African origin.

—13th c. Rise of Mali under the great Mande hero, Sundiata Keita. Ghana incorporated into the new great power. From its new capital at Niane on the Niger, Mali develops trade with the developing gold fields of the Akan in modern-day Ghana.

—14th c Empire of Mali dominates the Western half of West Africa, controlling the gold and salt trade; promoting Islam; and providing peace and prosperity to its region. Mansa Musa, the best known ruler of Mali, made the pilgrimage to Mecca.

—15th c. Mali suffers dynastic difficulties and economic challenges as the gold fields move further south and east. Songhai gains strength. Portuguese merchants begin trading directly with the Akan along the coast of modern Ghana.

—16th c. Songhai, with its capital at Gao replaces Mali as the imperial power of West Africa. Islamic learning flourishes with government patronage in the university town of Timbuktu.

—1591 Moroccan troops armed with guns cross the desert and defeat the army of Songhai, which break apart within a short time afterwards...

VARIOUS OTHER CHRONOLOGICALLY LAID OUT SITUATIONS TRANSCENDING WEST AFRICA

The following extract from Fred Wendorf & Romuald Schild (Evolutionary Anthropology 3(4), 1994)

[Note: The references and diagrams are not included. Please consult the original article]

[ca. 11ky - 12ky BP]

Early Neolithic

Radiocarbon dates indicate that the early Holocene rains began sometime before 10,000 B.P., perhaps as early as 11,000 or 12,000 B.P. However, there is no evidence of human presence before 9,500 B.P. except for a radiocarbon date of around 10,000 years ago from a hearth west of Dakhla. The earliest sites with large bovid remains are imbedded in playa sediments that overlay several meters of still older Holocene playa deposits.

All of these sites contain well-made, bladelet-based lithic assemblages. Straight-backed pointed bladelets, perforators, and large endscrapers made on reused Middle Paleolithic artifacts are the characteristic tools. A few grinding stones and rare sherds of pottery also occur. The pottery is well made; the pieces are decorated over their entire exterior surfaces with deep impressions formed with a comb or wand in what is sometimes referred to as the Early Khartoum style.

[ca. 8,200y - 9,500y BP]

These assemblages have been classified as the El Adam type of the Early Neolithic. Several radiocarbon dates place the complex between 9,500 and 8,900 B.P. There is no evidence that there were wells during this period. It is assumed, then, that these sites represent occupations that took place after the summer rains and before the driest time of the year when surface water was no anger available. Three of these sites, E-77-7, E-79-8, and E-80-4, all having only El Adam archeology and all located between km and 250 km west of Abu Simbel, have yielded, through excavation, more than 20 bones and teeth of large bovids that have been identified as Bos. These occurred along with several hundred bones of gazelle (Gazella dorcas and G. dama) and hare (Lepus capensis); a few bones of jackal (Canis aureus), turtle (Testudo sp.); and birds (Otis tarda and Anas querquedula); the large shell of a bivalve (Aspatharia rubens), probably of Nilotic origin; and various snail shells (Bulinus truncatus and Zoorecus insularis).

After a period of aridity around 8,800 years ago, when the desert may have been abandoned, the area was re-occupied by groups with a lithic tool-kit that emphasized elongated scalene triangles. The grinding stones, scrapers, and rare pieces of pottery that are present characterize the El Ghorab type of Early Neolithic and have been dated between 8,600 and 8,200 B.P. Oval slab-lined houses occur during this phase; all of them located in the lower pans of natural drainage basins. However, there are no known wells, suggesting that the desert still was not occupied during the driest part of the year. Faunal remains are poorly preserved in these sites and indeed, only one bone of a large bovid was recovered from the four sites with fauna in these sites the Dorcas gazelle is the most numerous, followed by hare, together with single bones of wild cat (Felis silvestris), porcupine (Hystrix cristata), desert hedge-hog (Paraechinus aethiopicus) an amphibian, and a bird.

[ca. 7,900y - 8,200k BP]

Another brief period of aridity be-tween 8.200 and 8,100 B.P. coincides with the end of the El Ghorab type of Early Neolithic in the desert. With the return of greater rainfall between 8.100 and 8+000 B.P., a new variety of Early Neolithic, the El Nabta type, appeared in the area. El Nabta sites are often larger than the previous Early Neolithic sites and usually have several large, deep wells, some with adjacent shallow basins that might have been used to water stock. A variety of lithic and bone tools occur in these sites, including stemmed points with pointed and retouched bases, perforators, burins, scrapers. notched pieces, bone points, and scalene triangles measuring about one centimeter. Grinding stones and shreds of pottery are more numerous than in the earlier sites, but still are not abundant. Their deeply impressed designs are similar to those on objects recovered from sites of the El Adam and El Ghorab types of Early Neolithic. Occasional pieces have "dotted wavy line" decoration.

Radiocarbon dates place the El Nabta sites between 8,100 and 7,900 B.P. One of these, E-75-6, is much larger than the others and consists of a series of shallow, oval hut floors arranged in two, possibly three, parallel lines. Beside each house was one or more bell-shaped storage pits; nearby were several deep (2.5 m) and shallow (1.5 m) water-wells. This site, located near the bottom of a large basin, was flooded by the summer rains. The houses were repeatedly used, probably during harvests in fall and winter Several thousand remains of edible plants have been recovered from these house floors. They include seeds, fruits, and tubers representing 44 different kinds of plants, including sorghum and millets. All of the plants are morphologically wild, but chemical analysis by infrared spectroscopy of the lipids in the sorghum indicates that this plant may have been cultivated. Of the four El Nabta sites that have yielded fauna, two contained bones of a large bovid identified as Bos. The faunal samples from the other two sites are very small.

[ca. 7,700y - 6,500y BP]

Middle Neolithic

Another brief period of aridity separated the El Nabta Early Neolithic from the succeeding Middle Neolithic, which is marked by the much greater abundance of pottery. In addition, each piece of pottery is decorated over its entire exterior surface with closely packed comb- or paddle-impressed designs. Some of the pots are large, and analysis of the clays indicates that they were made locally. There were also some changes in lithic tools. More of them were made of local rocks, but there was sufficient continuity in lithic typology to suggest that the preceding Nabta population was also involved.

Radiocarbon dates indicated an age for the Middle Neolithic between 7,700 and 6,500 B.P. The sites from the early part of this period range from one or two house homesteads in some of the smaller playas to multi-house villages in the larger basins. There is also one very large settlement along the beach line of the largest playa in the area, as well as, small camps on the sandsheets and the plateaus beyond the basins. This variation in site size has been interpreted as reflecting a seasonally responsive settlement system in which the population dispersed into small villages in the lower pans of the basins during most of the year, particularly the dry season, then, during the wet season, aggregated into a large community along the edge of the high-water stand of the largest playa.

Various house types are represented in the villages: some are circular and semi-subterranean (30 to 40 cm deep), some slab-lined, and others appear to have had walls of sticks and clay (wattle and daub). All of the sites have large, deep walk-in wells and storage pits. Except for the small camps, most of the sites appear to have been reused many times, with new house floors placed on top of the silt deposited during the preceding flood.

Excavations at five Middle Neolithic sites have yielded more than 50 bones from large bovids. Most of these bones came from the large "aggregation" site (E-75-8) at the margin of the largest playa in the area and from the early Middle Neolithic site E-77-l, dated before 7,000 B.P., which is located on a dune adjacent to another large playa. Each of the other three Middle Neolithic sites yielded only one to three large bovid bones.

Around 7,000 B.P., the remains of small livestock (sheep or goats) appear in several Middle Neolithic sites at Nabta. Because there are no progenitors for sheep or goats in Africa, these caprovines were almost certainly introduced from southwest Asia.

The faunal remains in many of these sites are extensive, including not only the same species recovered from the Early Neolithic sites, but also lizards (Lacertilia sp.) ground squirrel (Euxerus erythropus), field rat (Aricanthis nioloticus), hyena (Hyaena hyaena), and sand fox (Vulpes rueppelii). One bone is from either orstx (Oryx dammah) or addax (Addax nasosulcatus), The most nurmerous remains are those of hare and the Dorcas gazelle. Nevertheless, the paucity of the fauna and the absence, except for cattle and small livestock, of animals that require permanent water suggests a rather poor environment, most likely comparable to the northernmost Sahel today with about 200 mm of rain or less annually.

The Middle Neolithic was brought to an end by another major but brief period of aridity slightly before 6,500 B.P., when the water table fell several meters and the floors of many basins were deflated and reshaped, The area probably was abandoned at this time.

[ca. 6,500y - 5,300y BP]

Late Neolithic

With the increase in rainfall that began around 6,500 years ago. human groups again appeared in the area, but this time with ceramic and lithic traditions that differed from those of the preceding Middle Neolithic. This new complex, identified as Late Neolithic, is distinguished by pottery that is polished and sometimes smudged on the interiors. This pottery resembles that found in the slightly later (about 5,400 or, possibly, 6,300 B.P.) Baderian sites in the Nile Valley of Upper Egypt. [12, 13] It seems likely that an as yet undiscovered early pre-Badarian Neolithic was present in that area and either stimulated or was the source of the Late Neolithic pottery in the Sahara. It is unlikely, however, that this hypothetical early Nilotic Neolithic will date much earlier than 6,500 B.P. There are terminal Paleolithic sites along the Nile that are dated to around 7,000 B.P. and it is highly improbable that two such different life-ways could co-exist exist for long in the closely constrained environment of the Nile Valley.

Late Neolithic sites in the Egyptian Sahara consist mostly of numerous hearths representing many separate episodes of occupation. The hearths are long and oval, dug slightly into the surface of the ground, and filled with charcoal and fire-cracked rocks. No houses are known. Most of the sites are dry-season camps located in the lower parts of basins that were flooded by the seasonal rains. Many of the sites are associated with several large, deep wells.

Many of the Late Neolithic tools are made on "side-blow flakes" that have been retouched into denticulates and notched pieces There are also a few bifacial arrowheads, often with tapering stems, or, rarely with concave bases similar to those found in the Fayum Neolithic where they date between 6,400 and 5,7OO years ago. The end of the Late Neolithic in the Eastern Sahara is not well established.The period may have tasted until around 5,300 B.P. when this part of the Sahara was abandoned.

Due to poor preservation faunal remains in Late Neolithic sites are not as abundant as those from the Middle Neolithic. However, the Late and Middle Neolithic samples generally include the same animals suggesting that the environment was also generally similar during these periods. Although large bovids are also present in three Late Nealithic sites, and more frequently than in the faunal assemblages of the preceding period, they still are a minor component of the sample.

The Late Neolithic Nabta is marked by interesting signs of increased social complexity, including several alignments of updght slabs (2 x 3 m) imbedded in, and sometimes almost covered by, the playa sediments. Circles of smaller uptight stabs may calendrical devices. Stone-covered tumuli are also present; two of the smaller ones contain cow burials, one in a prepared and sealed pit. none of the more than 30 large tumuli thus far located, which are by large, roughly shaped blocks of stone, has been excavated.

Even the earliest of these early Holocene Eastern Sahara sites have been attributed to cattle pastoralists. It is presumed that these Early Neolithic groups came into the desert from an as yet unidentified area where wild cattle were present and the initial steps toward their domestication been taken.

This area may have been the Nile Valley between the First and Second Cataracts, where wild cattle were present. Moreover, lithic industries were closely similar to those in the earliest Saharan sites. It has been suggested that cattle may have facilitated human use of the Sahara by providing a mobile, dependable, and renewable source of food in the font of milk and blood. The use of cattle as a renewable resource rather than for meat is seen as a possible explanation for the paucity of cattle remains in most of the Saharan sites. Such use in a desert, where other foods were so limited, may have initiated the modern East African pattern of cattle pastonlism in which cattle are important as a symbol of prestige, are primarily used for milk and blood, and rarely are killed for meat.

It is assumed, because of the apparrent absence of wells at the earliest sites, that the first pastoralists used the desert only after the summer rains, when water was still present in the larger drainage basins. After 8,000 years ago, when large, deep wells were dug, the pastoralists probably resided in the desert year-round.

**Linguistic evidence**

In addition to the archeological and paleontological evidence, recent linguistic studies indicate the presence of early pastoralists in the Eastern Sahara. Detailed analysis of Nilo-Saharan root words has provided "convincing evidence" that the early cultural history of that language family included a pastoralist and food producing way of life, and that this occurred in what is today the south-western Sahara and Sahel belt.

The Nilo-Saharan family of languages is divided into a complex array of branches and subgroups that reflect an enormous time depth. Just one of the subgroups, Kir is as internally complex as the lndo-European family of languages and is believed to have a comparable age. The Sudanese branch is of special interest here. This is particularly true of the Northern Sudanese subfamily that includes a Saharo-Sahelian subgroup, the early homeland of which is placed in northwest Sudan and northeast Chad. Today, the groups that speak Saharo-Sahelian are dispersed from the Niger river eastward to northwestern Ethiopian highlands.

The Proto-Northern Sudanic language contains root words such as "to drive," "cow, "grain,""ear of grain," and "grindstone." Any of these might apply to food production, but another root word meaning "to milk" is cetainly the most convincing evidence of incipient pastoralism.

There are also root words for "temporary shelter" and "to make a pot." In the succeeding Proto-Saharo-Sahelian language, there are root words for "to cultivate", "to prepare field", to "clear" (of weeds), and "cultivated field." this is the first unambiguous linguistic evidence of cultivation. There are also words for "thombush cattle pen," "fence," "yard," "grannary," as well as "to herd" and "cattle." In the following Proto-Sahelian period, there are root words for "goat," "sheep," "ram," and "lamb," indicating the presence of small livestock.

There are root words for "cow," "bull," "ox," and "young cow" or "heifer" and, indeed, a variety of terms relating to cultivation and permanent houses.

On the basis of known historical changes in some of the language, Ehret estimates that the Proto-Northern Sudanic language family, which includes the first root words indicating cattle pastoralism, should be dated about 10,000 years ago. He also estimates that the Proto-Saharan-Sahelian language family, which has words indicating not only more complex cattle pastroalism, but the first indications of cultivation, occurred around 9,000 years ago. He places the Proto-Sahelian language at about 8,500 years ago.

These age estimates are just that, and should not be used to suggest any other chronology. Nevertheless, the sequence of cultural changes is remarkably similar to that in the archeology of the Eastern Sahara and, with some minor adjustments for the beginning of cultivation and for' the inclusion of "sheep" and "goat," reasonably closely to the radiocarbon chronology.

Evidence from other parts of North Africa

The antiquity of the known domes-tic cattle elsewhere in North Africa does not offer much encouragement with regard to the presence of early domestic cattle in the Eastern Sahara. Gautier recently summarized the available data, noting that domestic cattle were present in coastal Maurita-nia and Mali around 4,200 years ago and at Capeletti in the mountains of northern Algeria about 6,500 years ago. At about that same time, they may have been present in the Coastal Neolithic of the Maghreb. Farther south in the Central Sahara, domestic cattle were present at Meniet and Erg d'Admco, both of which date around 5,400 years ago, and at Adrar Rous, where a complete skeleton of a domestic cow is dated 5,760 +/- 500 years B.P ].

Domestic cattle have been found in western Libya at Ti-n-torha North and Uan Muhuggiag, where the lowest level with domestic cattle and small livestock (sheep and goats) dated at 7,438 t 1,200 B.P. At Uan Muhuggiag, there is also a skull of a domestic cow dated 5,950 +/- 120 years. In northern Chad at Gabrong and in the Serir Tibesti, cattle and small livestock were certainly present by 6,000 B.P. and may have been there as early as 7,500 B.P. We are skeptical, however, about the presence of livestock at Uan Muhuggiag and the Serir Tibesti before 7,OO0 B.P., when small livestock first appear in the Eastern Sahara, if we must assume that these animals reached the central Sahara by way of Egypt and the Nile Valley. This also casts doubt on the 7,500 B.P. dates for cattle in these sites.

The earliest domestic cattle in the lower Nile Valley have been found at Merimda, in levels that have several radiocarbon dates ranging between 6,000 and 5,400 B.P. and in the Fayum Neolithic, which dates from 6,400 to 5, 400 B.P. These sites also have domestic pigs and either sheep or goats. In Upper Egypt, the earliest confirmed domestic cattle are in the Predynastic site of El Khattara, dated at 5,300 B.P. However, domestic cattle were almost certainly present in the earliest Badarian Neolithic, which dates before 5,400 B.P. and possibly were there as early as 6,300 B.P. Farther south, in Sudan near Khartoum, the first do-mestic cattle and small livestock oc-curred together in the Khartoum Neolithic, which began around 6,000 B.P.

It is probably significant that none of the early Holocene faunal assemblages in the Nile Valley from the Fayum south to Khartoum that date between 9,000 and 7,000 B.P. contains the remains of cattle that have been identified as domestic It is this absence of any evidence of recognizable incipient cattle domestication in the Nile Valley or elsewhere in North Africa that cautions us to consider carefully the evidence of early domestic cattle in the Eastern Sahara.

...By employing the method of "strong inferences," which involves formulating alternative hypotheses, testing them to exclude one or more, arid adopting those that remain, we have concluded that domestic cattle probably were present in the Eastern Sahara as early as 9,000 years ago and, perhaps earlier. At the same time, we recognize that there is no such thing as proof and that science advances only by disproofs. Future evidence may suggest a better hypothesis or indeed, this controversy may be conclusively resolved if DNA testing now under way determines that the Bos remains found in African and Southwest Asian archaeological sites belong to the same closely related gene pool or that they represent two populations that have been separated for many thousands of years. Until then, Gautier's hypothesis of domestic cattle in the Eastern Sahara during the Early Holocene remains reasonable, if insecure.

Link: http://www.antiquityofman.com/cattle_domestication_wendorf1994.html

Speaking of DNA...

Non-human DNA has great potential for shedding light on cultural practices. Recent work by Daniel Bradley is a case in point. Before now it was assumed that cattle were first domesticated in the Near East. African, European, and Indian cattle were all thought to be descended from a domesticated Near Eastern progenitor, and to have developed into characteristic breeds afterward. Bradley and his colleagues have determined that Indian cattle broke off from an ancestral lineage between 117,000 and 275,000 years ago. The lineage split again about 22,000to 26,000 years ago into groups that gave rise to modern African and European cattle. These are startling results because cattle in the Near East were not domesticated until about 9,000 years ago, and cattle in India and Africa were genetically distinct before then. The latter two could not possibly be descended from domesticated Near Eastern cattle, as was thought, but must have been domesticated independently. - Courtesy Archaeological Institute of America, 1996.

MONSOON rain, or rather the lack of it, precipitated the rise of great civilisations in what is now the Sahara desert.

Extracts by Emma Young

Since prehistoric times people have been following the shifting monsoon rains around the Sahara, a practice that triggered the herding of livestock and even the development of the great pharaonic dynasties, say researchers who have re-examined archaeological sites across the region.

Rudolph Kuperand Stefan Kröpelin of the Institute of Prehistoric Archaeology at the University of Cologne, Germany, studied geological and ecological data for clues to patterns of past rainfall. They also examined radiocarbon dates of dwellings and artefacts from 150 archaeological sites stretching from the far north of the eastern Sahara to the south, which allowed them to identify four main phases of human occupation of the desert (Science, DOl: 10.1126/science.1130989).

c.10.5ky ago ~ 8,500 BC to 7.5ky ago ~ 5,500 BC:
Starting around 8500 BC, and continuing over the next few centuries, the lower boundary of the desert shifted about 800 kilometres north, bringing monsoon rains to barren lands. People living in the south followed the rains north, rapidly occupying the entire eastern Sahara. For about the next 3000 years, the climate was relatively stable. During this time, human settlements became well established, and people began to keep livestock.

c.7.3ky ago ~ 5300 BC:
Then, around 5300 BC, monsoons failed to reach the Egyptian Sahara. People began to retreat, along with their cattle, into places such as the banks of the Nile where there was still enough rainfall and surface water to meet their needs. "We are convinced that the emergence of the pharaonic civilisation in the Nile Valley in about 3500 BC was not coincidental - but triggered by the onset of full desert conditions in most of Egypt outside the Nile valley and a few oases," Kropelin says.

c.5.5ky ago to c.3.5ky ago ~ 3500 and 1500 BC:
Finally, between 3500 and 1500 BC, lack of rain drove people to maintain permanent settlements in the south of the region only. This exodus introduced the Neolithic way of life into sub-Saharan Africa, including pastoralism - and even today keeping livestock is one of the most important African economies.

Source: By Emma Young - Copyright Reed Business Information UK Jul 29-Aug 4, 2006

Courtesy of metmuseum.org, we have:

814 B.C. Tradition preserves this date as the year in which Phoenician colonists from the Levant establish the city of Carthage on the coast of modern-day Tunisia. The native peoples are hostile to the Phoenicians and require tribute, such as rent on their land, through the fifth century B.C. With the decline of Phoenician power and the destruction of Tyre in the sixth century B.C., Carthage emerges as a trading center in its own right.

• ca. 500 B.C. Carthaginian ships carry metals, oil, wine, grain, and other products to ports throughout the western Mediterranean. In order to protect their mercantile interests, they establish trading posts in Sicily and Sardinia and on the southern coast of modern France. Competition for control of shipping leads them into sporadic armed conflict with Greek and Etruscan forces. Through trade, Carthage emerges as one of the richest and most powerful cities in the Mediterranean. Objects made in Carthage reflect artistic styles imported from the Near East, Etruria, Egypt, and the Greek city-states. Among the luxury goods manufactured here are perfume, glassware, ivory carvings, fine woodwork, and precious purple dye.

• 264 B.C. Rome, which has subdued its Greek and Etruscan neighbors, continues an expansion that threatens Carthaginian trade concerns. The First Punic (Carthaginian) War breaks out, with many major battles fought on sea. In 241 B.C., peace is declared, and the Carthaginians are forced to pay a large indemnity to Rome. Hamilcar Barca, commander of the Carthaginian army, goes to Spain in 237 B.C. and begins to conquer territory along the Mediterranean coast, ostensibly to raise money for the indemnity. In Hamilcar's entourage is his nine-year-old son Hannibal.

• 238 B.C. Masinissa becomes king of the united Numidian tribes. The many groups of Numidian nomads had begun to confederate in the third century B.C. Masinissa encourages settled agriculture, urban developments, and Carthaginian customs.

• 218 B.C. Hannibal (247–183 B.C.), commander of the Carthaginian forces, leads his troops from Spain through the passes of the Pyrenees and Alps into Italy. With him are thirty-seven elephants of war. These events mark the outset of the Second Punic War, another long campaign that drains the strength not only of Rome and Carthage but also of the Greek-speaking kingdoms in the eastern Mediterranean. The Roman general Scipio Africanus eventually destroys Hannibal's forces at Zama, North Africa, in 202 B.C., and the Roman terms of peace dismember the Carthaginian empire. Hannibal continues to scheme against the Romans until his death, perhaps by suicide, in 183 B.C.

• 149 B.C. Despite defeat, Carthage regains its economic strength. New buildings are raised, including a residential quarter. Recovery in Carthage causes anxiety in Rome. The Romans send an army to besiege the city. When it surrenders in 146 B.C., the Romans wreak merciless destruction, leveling the once proud city, enslaving the people, and cursing the very ground against any subsequent habitation.

• ca. 140 B.C. A richly colored marble, called giallo antico in the Renaissance, is first quarried in Chemtou (in present-day Tunisia). The characteristic color of Chemtou marble is a golden yellow, but it also contains streaks of rose, blood red, and green. The quarries, first operated by the Numidian kings and later by the Roman emperors, supply stone for lavish building enterprises throughout the Mediterranean, including the Forum of Augustus (ca. 12 B.C.) and the Pantheon (ca. 130 A.D.) in Rome.

• 46 B.C. The Numidian kingdom comes to an end under Juba I, who entered the fierce civil wars among the Romans on the side of Pompey, defeated by Julius Caesar. Receptive to both Carthaginians and Hellenistic Greek customs, the Numidians had splendid palaces in the Hellenistic style, Greek philosophers to counsel them, and temples dedicated to the Phoenician god Baal Hammon, sometimes assimilated into the Greek Zeus. In Caesar's triumphal procession, resplendent booty worthy of Numidian wealth and taste is paraded through the streets of Rome, along with Juba II, infant son of the defeated king.

• 25 B.C. Augustus, who emerges victorious at Rome after a century of war, grants Juba II the client kingship of Mauritania. His domain corresponds to a portion of the former Numidian kingdom. Reared at Rome, Juba II is a man of extraordinary learning, a collector and a patron of the arts. He marries Cleopatra Selene, daughter of the great Cleopatra defeated by Augustus. Copies of Greek statues adorn his palace, and he authors several volumes in Greek on a wide range of subjects, including a history of Rome, the antiquities of various nations, and research on language and the theater.

...

• 11th century The Sefawa dynasty establishes a capital at Njimi and controls the trade in ivory, ostrich feathers, and slaves.

• 11th–15th/16th century Resisting conversion to Islam, Tellem people migrate from the Inland Niger Delta and Jenne-Jeno to the Bandiagara Escarpment.

• ca. 1180–1230 Under the Kante dynasty, the Soso kingdom expands to absorb much of ancient Ghana.

• ca. 13th century A clan breaks away from the troubled dynasties of the Kanem kingdom in central Sudan. Settling to the southwest of Lake Chad, this splinter population becomes the Borno kingdom. In the fifteenth century, Borno establishes trade links with the Hausa, supplying salt and horses in exchange for Akan gold. The Hausa are peoples born of the encounter between southern Saharan nomads and local mixed farmers of the northern Nigerian savanna.


• ca. 13th century Muslim Soninke found the city of Jenne in the Inland Niger Delta, a site that will grow to become one of the most famous centers in the region. (Oral tradition maintains that Jenne was established much earlier, during the eighth century.) The Great Mosque is dedicated around this time by Koi Konboro, the twenty-first king of Jenne and the first to convert to Islam. Politics dictate that the mosque be rebuilt more than once, and its original appearance is no longer certain. The remarkable adobe mosque that stands there today was erected in 1906–7.
...


• 1312 Mansa Kankan Musa I becomes emperor of Mali, guiding the empire through its most prosperous years, enhancing trade, expanding borders, and sponsoring mosques. While undertaking a spectacular pilgrimage to Mecca in 1324–25, he stops en route in Cairo, where he dispenses so much gold that the precious metal is devalued for years. Returning to Mali in 1325, Musa is informed that his forces have just conquered the kingdom of Gao, where he is said to have subsequently dedicated a mosque. Djinguere Ber at Timbuktu is the most famous mosque traditionally associated with Mansa Musa. He is represented holding gold nuggets on a map dated to 1375, drawn in Spain.


• ca. 1352 Ibn Battuta, renowned global traveler and writer, spends a year in Mali and records his observations. Although Mansa Musa is deceased by this time, the empire is still vigorous. Battuta is especially impressed with the strict order and justice enforced by the resident Malian king.

• 14th–15th century Gao and the western part of Songhai state are brought within the boundaries of Mali during the fourteenth century. But the greater part of Songhai remains beyond Mali's tax-collecting orbit. With the decline of Mali in the fifteenth century, Songhai shows its independence. Under Sonni cAli the Great (r. 1464–92), the Songhai become an empire, totally eclipsing Mali. Sonni cAli captures Timbuktu in 1468. The Songhai empire collapses with the Moroccan invasion of 1591.


— ca 5000 y ago - IRON IN AFRICA:

Courtesy UNESCO.org

The theory that sub-Saharan Africa borrowed its iron technology from other cultures is no longer tenable. The fact is that the continent invented and developed its own iron metallurgy as far back as the third millennium B.C.

Author(s) I.A. Akinjogbin, D.A. Aremu, H. Bocoum, P. de Maret, J.M. Essomba, P. Fluzin, J.F.Jemkur, L.-M. Maes Diop, B. Martinelli, G. Quéchon, E.E. Okafor, A. Person. Prefaced by Doudou Diène. Edited by Hamady Bocoum.
Publication Date 01 Jan 2004

REVISING THE HISTORY

24-06-2002 - Africa developed its own iron industry some 5,000 years ago, according to a formidable new scientific work from UNESCO Publishing that challenges a lot of conventional thinking on the subject.

Iron technology did not come to Africa from western Asia via Carthage or Merowe as was long thought, concludes "Aux origines de la métallurgie du fer en Afrique, Une ancienneté méconnue: Afrique de l'Ouest et Afrique centrale". The theory that it was imported from somewhere else, which—the book points out—nicely fitted colonial prejudices, does not stand up in the face of new scientific discoveries, including the probable existence of one or more centres of iron-working in west and central Africa and the Great Lakes area.

The authors of this joint work, which is part of the "Iron Roads in Africa" project (see box), are distinguished archaeologists, engineers, historians, anthropologists and sociologists. As they trace the history of iron in Africa, including many technical details and discussion of the social, economic and cultural effects of the industry, they restore to the continent "this important yardstick of civilisation that it has been denied up to now," writes Doudou Diène, former head of UNESCO's Division of Intercultural Dialogue, who wrote the book's preface.

But the facts speak for themselves. Tests on material excavated since the 1980s show that iron was worked at least as long ago as 1500 BC at Termit, in eastern Niger, while iron did not appear in Tunisia or Nubia before the 6th century BC. At Egaro, west of Termit, material has been dated earlier than 2500 BC, which makes African metalworking contemporary with that of the Middle East.

..."In fact, only in Africa do you find such a range of practices in the process of direct reduction [a method in which metal is obtained in a single operation without smelting],and metal workers who were so inventive that they could extract iron in furnaces made out of the trunks of banana trees," says Hamady Bocoum, one of the authors.

This ingenuity was praised in the early 19th century by the Tunisian scholar Mohamed el-Tounsy, who told of travelling in Chad and Sudan and coming across spears and daggers made "with the skill of the English" and iron piping with "bends and twists like some European pipes, but more elegant and graceful and shining so brightly they seem to be made of silver."

Seeking Africa's first Iron Men.

Heather Pringle

Courtesy of Science 2009.

"Now controversial findings from a French team working at the site of Ôboui in the Central African Republic challenge the diffusion model. Artifacts there suggest that sub-Saharan Africans were making iron by at least 2000 B.C.E. and possibly much earlier—well before Middle Easterners, says team member Philippe Fluzin, an archaeometallurgist at the University of Technology of Belfort-Montbéliard in Belfort, France. The team unearthed a blacksmith's forge and copious iron artifacts, including pieces of iron bloom and two needles, as they describe in a recent monograph, Les Ateliers d'Ôboui, published in Paris. "Effectively, the oldest known sites for iron metallurgy are in Africa," Fluzin says."
... 

Fumes (Augustin) Holl - "People just have this conception that iron teechnology in sub-saharan Africa has to be later than 500 B.C.E., and when it is earlier than that, they start looking for [alternative] explanations."

*Recalling: 

ca. 11,000 BP: Archeological indicators of Yam cultivation in west Africa in the vicinity of the Niger delta region.

Well, expanding on that a little, we have from Chris Ehret... 

The story of the Guinea Coast rice farmers is simply one example of the immense diversity of African agricultural inventiveness over the long course of history-and a relatively late example at that. We now know that the history of cultivation and livestock-raising in Africa extends almost 11,000 years ago. By 8500 BCE, at about the same time as peoples in the Middle East began for the first time to cultivate wheat and barley, African communities living more than 1,000 kilometres to the south separately and independently became the earliest known raisers of cattle in the world.By around 7000-6000 BCE, the descendants of these first cattle keepers started also to cultivate crops. The early staple of their "Sudanic" agriculture was sorghum, now a crop of almost worldwide importance (see photos, courtesy of the author).

Still another independent invention of agriculture took place in West Africa among early inhabitants speaking languages of the Niger-Congo family. The West African cultivation ideas are also very old, possibly dating as long ago as 9000-7000 BCE. The early staple of this agriculture was probably the Guinea yam, but West African farmers also domesticated a number of other crops, now well known outside Africa, including okra and black-eyed peas (cow-peas). Over the past 4,000 years in the more western parts of West Africa, another crop, African rice, replaced yams in importance.


Archaeology provides part of our knowledge of this history, but a great many areas of Africa remain still poorly known to archaeologists. So, in African historical studies, scholars have turned increasingly to linguistic reconstruction of the past.


Source: Christopher Ehret, Implications for Agriculture and Development 

Recalling...

• 14th–15th century Gao and the western part of Songhai state are brought within the boundaries of Mali during the fourteenth century. But the greater part of Songhai remains beyond Mali's tax-collecting orbit. With the decline of Mali in the fifteenth century, Songhai shows its independence. Under Sonni cAli the Great (r. 1464–92), the Songhai become an empire, totally eclipsing Mali. Sonni cAli captures Timbuktu in 1468. The Songhai empire collapses with the Moroccan invasion of 1591.

Stephen Cory of the University of California at Santa Barbara tells us about the damaging and long term impact of the Moroccan invasion on both Morocco and sub-Saharan West Africa's future [that is to say, West Africa's state today], which derserves to be a topic on its own and indeed will be the subject of a future blog posting here... 

Through this study, I have sought to demonstrate the long-lasting connections between North Africa and sub-Saharan Africa.

Although
these connections existed centuries before the coming of Islam, they grew stronger throughout the Islamic period.

During the sixteenth century, the Sa'di sultan Ahmad al-Mansur
observed the economic, cultural, and religious connections between the two regions, and argued that there ought to be political unification between them as well.

And yet, it was
at this point that things broke down, as al-Mansur was unable to achieve his dream of a caliphate that spanned both sides of the Sahara. The unification project for such a broad expanse of territory was too difficult for a moderately-powerful state, lacking in sophisticated infrastructure, such as Morocco, to achieve. Despite the existence of these many inter-connections, they were insufficient to support political unification.

In fact, if Kaba's argument is correct, al-Mansur's attempt at integrating West Africa into his state
had long-lasting disastrous consequences for both North and West Africa.

By destroying the strongest centralized state in sub-Saharan Africa, al-Mansur's invasion did irreparable damage to the trans-Saharan trade routes that had enriched both Morocco and West Africa. Instead, this trade increasingly began to be diverted to the south, where it was accessed by European merchants along the Gold and Slave Coasts. And the process of devoting all of the state's efforts towards the invasion exhausted the Sa'di dynasty, making it extremely vulnerable to outside interference and collapse, once misfortune hit in the form of the plague and various famines. The sons of al-Mansur tore his dynasty apart after his death, and Morocco would never again challenge for supremacy in the Islamic or Mediterranean worlds.

In attempting to establish a form of African political unity, al-Mansur
**hastened division and decline, leaving West Africa unprotected before the European onslaught that was to come in the following centuries.25**

Turning to Art in the Sahara...


What to make of this diagrammatical layout of chronology? 

Well, for one the authors make it clear that they weren't able to use C14 dating*, but rather:

"It was not possible to get a radiometric age for any style: the chemical tests on some samples of paintings did not detect enough organic material to allow 14C dates. So we did not continue with the samplings. We have dated the paintings on the basis of depicted weapons and texts (Fig. 11)."

...and go onto say:

"The most ancient, the Dancers’ Style, belongs to an early or medium Bronze Age (3,800-3,200 BP), as the depiction of halberds shows. The most recent, the Lineal Style, should be dated between 2,400 BP and the beginning of the Christian era (or still later) because of the presence of Lybico-Berber texts and the lack of camels. The chronology of the Shaped, Stroked and Dark Figure styles lies between the ages of the Dancers and the Lineal styles. Finally, there is also a unique ancient Arabic text, which might represent the historic ages after the XVth century AD.

All but the Lineal Style depict similar subjects although not the same themes. In the Dancers’ Style, the processions of people, which carry throwing-sticks and seem to dance, constitute the most typical theme. There are also people with bovines depicted and meetings in which children are also present. In the Shaped Style, depictions of very dynamic people and very realistic bicolour antelopes are found. In its Outlined sub-style, only antelopes, giraffes, bovines and ostriches are depicted, always in large dimensions (more than one meter long). The same kinds of animals and with similar sizes are depicted in the Stroked Style in which series of giraffes are the most typical theme. In the Dark Figures style, men, women, gazelles, elephants and small quadrupeds (maybe dogs) are depicted. The compositions are always organized in lines of these main subjects. The main theme is a series of small gazelles (each one being about 10cm long). Another common theme among the Dark Figures style is the hunting of an elephant. Some bicolour gazelles longer than one meter belong to this style too. Finally, in the Lineal Style, non-figurative images and very schematized humans and quadrupeds are depicted. In this style, the typical pan-Saharan theme of an ostrich hunted by two horsemen is also found. The Lybico-Berber texts belong to this latest style.

Regarding the relation between paintings and engravings in the Western Sahara, we think that it is possible to link a pictorial style with a style of engravings. As the comparison of the images shows, the Dancers’ Style, the most ancient, can be related to the Tazina Style of engravings on the basis of the human depictions, morphologically very similar in both styles. In the examples coming from the Wadi Ben Sacca (Milburn 1971) and the Meicateb well (Mateu 1945-46) all the figures have bent legs, always ahead of the body, and unstable positions, with L-shaped feet and fingers on their hands. Although the following are not strictly stylistic elements, in both cases humans carry similar weapons, skirts and headdress too. So the research on the paintings of the Zemmur indicates that the Tazina engravings might also be dated to the early Bronze Age.


Discussion and conclusions

At the beginning of the research we assumed that most of the pictures belonged to prehistoric times because they depicted elephants and rhinoceros and people were carrying bows. We thought so because many researchers tend to use the presence of those animals and weapons as evidence to consider these kinds of depictions as very ancient ones, anterior to 4,000 BP. Around that period, a progressive aridification might have begun and those researchers guess that those animals could not live in the Western Sahara anymore. Our later research has shown that most of the images of the Zemmur are certainly prehistoric but also demonstrate that the use of those species as dating elements could be misleading. It is true that many of them were extinct in the area many centuries ago, some of them before the Christian era, as we know from the classic and Arabic sources. But it is also true that they still lived in the Western Sahara in the Bronze Age and later. For example, an elephant and a rhinoceros appear in a panel with people carrying swords, which are recent weapons.

So we must conclude that in the Western Sahara the presence of those species does not automatically assign a date previous to 4,000 BP to the style in which they are depicted. At least in the Western Sahara, we should not use the depictions of those wild animals as reliable dating elements.

The depiction of some weapons like bows and throwing sticks has been used in a similar way. In our opinion this should be avoided too, at least in the Western Sahara, where people using throwing sticks and bows appear at the same time and later than people carrying halberds. On the other hand, swords, spears and shields always appear related to the most recent style, the Lineal Style, itself related to Lybico-Berber inscriptions.

Because very few archaeological excavations have been done in the Western Sahara, we still have no clear and safe sequence of the prehistoric cultures that occupied the region. As a consequence, it is difficult to link any of the rock art remains with a prehistoric culture. If we could obtain an absolute radiometric age for any of the styles, it would still be difficult to relate it with any cultural period or other material remains. Thus, two of the major problems concerning the Zemmur paintings
—the interpretation and the cultural identity of their authors—still remain unresolved.

We can also conclude that most of the prehistoric painting styles of the Western Sahara are different from those in the central Sahara. However this mainly applies to the technical side of the styles. On the other hand, the subjects and some themes are similar to those depicted in some Écoles du Bovidien Final (Iheren-Tahilahi, Ouan Amil and Ti-n-Anneuin) in the central Sahara (Muzzolini 1995). The dates we propose here for the rock-paintings of the Zemmur agree with the ones Muzzolini proposed for the Écoles du Bovidien Final too.

Some of these newly-defined styles are found only in the Zemmur rock-shelters but this fact could change soon as the research continues further.


Courtesy INORA Online: http://www.bradshawfoundation.com/inora/discoveries_45_3.html


*— Should the link be broken, refers to:

Dating art imprinted on stones, are pretty much guesses or approximations based on carbon-dating of organic matter on and/or around the said stones and perhaps on the material used to draw on the said stones, since apparently, the stones themselves cannot be dated via carbon-dating.

See, for example:

The criteria of direct rock art dating are clear, precise and rigorous. Direct dating does not produce actual ages of rock art, it generates testable propositions about the relevance of specific physical or chemical data to the true age of rock art. The interpretation of the relation demands a considerable understanding of the dating technique used; of the circumstances of sample collection, processing and distorting factors; and of the limitations and quite specific qualifications applying to the stated results. None of the methods used in direct dating of rock art produces results that can be conveyed by some simple numerical expression, which unfortunately is how they are often quoted in the archaeological literature. Therefore it is fair to say that archaeologically published results of direct dating are often presented in a misleading form. Such results should always be understood within the context they were acquired and within which the archaeometrists expect them to be seen (Bednarik 1996, 2000a; Watchman 1999).

Consider, for instance, the ubiquitous radiocarbon analysis results, and the way they are misused (see Pitfalls in rock art dating).

There are very few kinds of circumstances in which a carbon-14 result can directly be related to the age of rock art, and
so far (in 2001) no rock art has been dated by radiocarbon.

This is not what one would be led to believe if one sifted through recent archaeological commentaries.
- Robert G. Bednarik

http://mc2.vicnet.net.au/home/date/web/direct.html

— ca. 100 ky ago or more, going southward...

Oldest Jewelry? "Beads" Discovered in African Cave -
National Geographic.

The presence of beads, whether used as trade items, to convey group status, or to identify group members or relationships within a group suggests some form of language existed, says Henshilwood, who is affiliated with the University of Bergen, Norway, and the State University of New York.

"What the beads might symbolize is unknown, but it does imply that there had to be some means of communicating meaning, which plausibly is language," Henshilwood said. "Everyone knew what it meant, just as today if you're wearing Gucci sunglasses or a diamond tennis bracelet, there's a message being put out."


Related to the above, are topics of:

—Is Bead Find Proof Modern Thought Began in Africa?

—African Bone Tools Dispute Key Idea About Human Evolution When Did Modern Behavior Emerge in Humans?

Continuing with the National Geographic piece, Hensilwood tells us...

Recent studies have suggested that Khoisan, a southern African language that includes many clicks, could be as many as 100,000 years old. It's possible the people at Blombos were speaking in some form of click language, Henshilwood said....

Speaking of which, as the present author posted elsewhere...

As we go further back in time, it becomes clear that the Khoisan languages are just but among the various oldest languages spoken on the continent, with traits such as the "clicking" sound. And these populations, as it turns out, aren't necessarily as genetically close, as one would imagine:

African Y chromosome and mtDNA divergence provides insight into the history of click languages.

Knight A, Underhill PA, Mortensen HM, Zhivotovsky LA, Lin AA, Henn BM, Louis D, Ruhlen M, Mountain JL.

Department of Anthropological Sciences, Stanford University, Stanford, CA 94305, USA. aknight@stanford.edu

BACKGROUND: About 30 languages of southern Africa, spoken by Khwe and San, are characterized by a repertoire of click consonants and phonetic accompaniments. The Jumid R:'hoansi (!Kung) San carry multiple deeply coalescing gene lineages. The deep genetic diversity of the San parallels the diversity among the languages they speak. Intriguingly, the language of the Hadzabe of eastern Africa, although not closely related to any other language, shares click consonants and accompaniments with languages of Khwe and San.

RESULTS: We present original Y chromosome and mtDNA variation of Hadzabe and other ethnic groups of Tanzania and Y chromosome variation of San and peoples of the central African forests: Biaka, Mbuti, and Lisongo. In the context of comparable published data for other African populations, analyses of each of these independently inherited DNA segments indicate that click-speaking Hadzabe and Jumid R:'hoansi are separated by genetic distance as great or greater than that between any other pair of African populations. Phylogenetic tree topology indicates a basal separation of the ancient ancestors of these click-speaking peoples. That genetic divergence does not appear to be the result of recent gene flow from neighboring groups.

CONCLUSIONS: The deep genetic divergence among click-speaking peoples of Africa and mounting linguistic evidence suggest that click consonants date to early in the history of modern humans. At least two explanations remain viable. Clicks may have persisted for tens of thousands of years, independently in multiple populations, as a neutral trait.

Alternatively, clicks may have been retained, because they confer an advantage during hunting in certain environments.

Source:http://www.bec.ucla.edu/papers/Mountain_3-7-05.pdf


Moving to the southeastern corner of the continent. In an area of Africa rarely talked about: 

Madagascar!... 

ca 2000 to 1500 years ago: Movement of people from southeast Asia to the southeast African coast, as part of the bidirectional movement of people in the said regions, according to the following: 

Migration of people from southeast Asia about 2000-1500 years ago - a mirror image of the migrations from that region into the Pacific, to Micronesia and Polynesia, that had occurred about 1000 years earlier.

The cryptic past of Madagascar 

Human inhabitants of Madagascar are genetically unique 

Half of the genetic lineages of human inhabitants of Madagascar come from 4500 miles away in Borneo, while the other half derive from East Africa, according to a study published in May by a UK team.

The island of Madagascar, the largest in the Indian Ocean, lies some 250 miles (400 km) from Africa and 4000 miles (6400 km) from Indonesia. Its isolation means that most of its mammals, half of its birds, and most of its plants exist nowhere else on earth. The new findings, published in the American Journal of Human Genetics, show that the human inhabitants of Madagascar are similarly unique - amazingly, half of their genetic lineages derive from settlers from the region of Borneo, with the other half from East Africa. Archaeological evidence suggests that this settlement was as recent as 1500 years ago - about the time the Saxons invaded Britain.

"The origins of the language spoken in Madagascar, Malagasy, suggested Indonesian connections, because its closest relative is the Maanyan language, spoken in southern Borneo," said Dr Matthew Hurles, of the Wellcome Trust Sanger Institute. "For the first time, we have been able to assign every genetic lineage in the Malagasy population to a likely geographic origin with a high degree of confidence."

"**Malagasy peoples are a roughly 50:50 mix of two ancestral groups: Indonesians and East Africans.** It is important to realise that these lineages have intermingled over intervening centuries since settlement, so modern Malagasy have ancestry in both Indonesia and Africa."

The team, from Cambridge, Oxford and Leicester, used two types of DNA marker to study DNA diversity: Y chromosomes, inherited only through males, and mitochondrial DNA, inherited only through females. They tested how similar the Malagasy were to populations around the Indian Ocean. The set of non-African Y chromosomes found in the Malagasy was much more similar to the set of lineages found in Borneo than in any other population, which demonstrates striking agreement between the genetic and linguistic evidence. Similarly, a 'Centre of Gravity' was estimated for every mitochondrial DNA to suggest a likely geographical origin for each. This entails calculating a geographical average of the locations of the best matches within a large database of mitochondrial lineages from around the world.

"The Centres of Gravity fell in the islands of southeast Asia or in sub-Saharan Africa," explained Dr Peter Forster, from the McDonald Institute for Archaeological Research, University of Cambridge, one of the co-authors. "The evidence from these two independent bits of DNA supports the linguistic evidence in suggesting that a migrating population made their way 4500 miles across the Indian Ocean from Borneo."

The striking mix suggests that there was substantial migration of people from southeast Asia about 2000-1500 years ago - a mirror image of the migrations from that region into the Pacific, to Micronesia and Polynesia, that had occurred about 1000 years earlier. However, unlike the privations suffered by those eastward travellers, the data suggests the early Malagasy population survived the voyage well, because more genetic variation is found in them than is found in the islands of Polynesia. 'Bottlenecks' in evolutionary history, where the population is dramatically reduced in number, are a common cause of reduced genetic variation.

Even though the Africa coast is only one-twentieth of the distance to Indonesia, it appears that migrations from Africa may have been more limited, as less of the diversity seen in the source population has survived in Madagascar.

But why, if the population is a 50:50 mix, is the language almost exclusively derived from Indonesia?

"It is a very interesting question, for which we have as yet no certain answer, as to how the African contribution to Malagasy culture, evident in biology and in aspects of economic and material culture, was so largely erased in the realm of language," commented Professor Robert Dewar, of The McDonald Institute for Archaeological Research, University of Cambridge. "This research highlights the differing, and complementary, contributions of biology and linguistics to the understanding of prehistory."

The population structure in Madagascar is a fascinating snapshot of human history and a testament to the remarkable abilities of early populations to undertake migrations across vast reaches of ocean. It may also be important today for cutting edge medical science. 

"There has recently been dramatic progress in the development of experimental and statistical methods appropriate for gene mapping in admixed populations," said David Goldstein, Wolfson Professor of Genetics, University College London. "To succeed, however, these methods depend on populations with well defined historical admixtures. This work shows provides compelling evidence that the Malagasy are such a population, and again shows the value of careful study of human population structure."

Our human history is a rich mix of peoples and their movement, of success and failure. Madagascar holds an enriching tale of the ability of humans to survive and to reach new lands.


Notes to Editors:

Participating Centres -

Wellcome Trust Sanger Institute - Wellcome Trust Genome Campus, Hinxton, UK; McDonald Institute for Archaeological Research - University of Cambridge, Cambridge, UK; Weatherall Institute for Molecular Medicine - University of Oxford, Oxford, UK; Department of Genetics - University of Leicester, Leicester, UK

Publication details:

The dual origin of the malagasy in island southeast Asia and East Africa: evidence from maternal and paternal lineages.

Hurles ME, Sykes BC, Jobling MA, Forster P

Am J Hum Genet. 2005;76;894-901. PMID: 15793703

Source: Wellcome Trust Sanger Institute

Got the present author thinking: If it is said that,...

there was substantial migration of people from southeast Asia about 2000-1500 years ago - amirror image of the migrations from that region into the Pacific, to Micronesia and Polynesia, that had occurred about 1000 years earlier. However, unlike the privations suffered by thoseeastward travellers, the data suggests the early Malagasy population survived the voyage well, because more genetic variation is found in them than is found in the islands of Polynesia. 'Bottlenecks' in evolutionary history, where the population is dramatically reduced in number, are a common cause of reduced genetic variation.

Even though the Africa coast is only one-twentieth of the distance to Indonesia, it appears thatmigrations from Africa may have been more limited, as less of the diversity seen in the source population has survived in Madagascar.


...then in which populations, would such recent migrations from the African coast possibly be reflected? Well, the following should instruct on the answer to this question...

Recap: "**Malagasy peoples are a roughly 50:50 mix of two ancestral groups: Indonesians and East Africans.** It is important to realise that these lineages have intermingled over intervening centuries since settlement, so modern Malagasy have ancestry in both Indonesia and Africa."

Details of genetics:

The Dual Origin of the Malagasy in Island Southeast Asia and East Africa: Evidence from Maternal and Paternal Lineages

Matthew E. Hurles,1,2 Bryan C. Sykes,3 Mark A. Jobling,4 and Peter Forster2

Linguistic and archaeological evidence about the origins of the Malagasy, the indigenous peoples of Madagascar, points to mixed African and Indonesian ancestry. By contrast, genetic evidence about the origins of the Malagasy has hitherto remained partial and imprecise. We defined 26 Y-chromosomal lineages by typing 44 Y-chromosomal polymorphisms in 362 males from four different ethnic groups from Madagascar and 10 potential ancestral populations in Island Southeast Asia and the Pacific. We also compared mitochondrial sequence diversity in the Malagasy with a manually curated database of 19,371 hypervariable segment I sequences, incorporating both published and unpublished data. We could attribute every maternal and paternal lineage found in the Malagasy to a likely geographic origin. Here, we demonstrate approximately equal African and Indonesian contributions to both paternal and maternal Malagasy lineages. The most likely origin of the Asia-derived paternal lineages found in the Malagasy is Borneo. This agrees strikingly with the linguistic evidence that the languages spoken around the Barito River in southern Borneo are the closest extant relatives of Malagasy languages. As a result of their equally balanced admixed ancestry, the Malagasy may represent an ideal population in which to identify loci underlying complex traits of both anthropological and medical interest.

The island of Madagascar lies in the Indian Ocean, 250 miles from the African coast and 4,000 miles from Indonesia. Paleoecological and archaeological evidence suggest that,
by 1,500-2,000 years ago, Madagascar had become the last great island landmass to be settled (Dewar and Wright 1993; Burney et al. 2004). The Malagasy language shares 90% of its basic vocabulary with Maanyan, a language spoken in the Barito River region of southern Borneo, which indicates that the predominant ancestry of the Malagasy language most likely derives from Borneo (Dahl 1951; Adelaar 1995). Malagasy also contains linguistic borrowings from the Bantu languages spoken in East Africa (Dahl 1988). Furthermore, substantial components of Malagasy material culture (e.g., cattle pastoralism) could be derived only from African sources.

At the time of the first Madagascan settlement, the entire Indian Ocean was a vast trading network connecting China with the Mediterranean and all societies in between (Vérin and Wright 1999). There is
substantial evidence of Islamic influence and limited evidence of Indian influence on the Malagasy, in both language and culture.

In contrast to these cultural and linguistic traces of Malagasy ancestry, the genetic origins of the Malagasy are relatively poorly understood, and conflicting signals of African, Asian, and Pacific origin have appeared from studies of different loci (Migot et al. 1995; Soodyall et al. 1995; Hewitt et al. 1996). These contradictions result, in part, from being able to identify the likely origins of only a subset of lineages present at any single locus.

In the present study, we employed the detailed phylogenetic and geographic resolution of paternally inherited Y-chromosomal lineages and maternally inherited mtDNA lineages to apportion Malagasy lineages to ancestral populations. In this way, the contributions of the different ancestral populations to the modern Malagasy gene pool can be estimated directly, and likely geographic origins can be pinpointed with precision.

We assayed mtDNA and Y-chromosomal diversity in a Malagasy population sample comprising four different ethnic populations: Bezanozano (n = 6), Betsileo (n = 18), Merina (n = 10), and Sihanaka (n = 3). Ten potential ancestral populations (n = 327) representing major population groups within Island Southeast Asia and Oceania were also analyzed with Y-chromosomal markers. To type all these samples for the required number of Y-chromosomal and mitochondrial (mt) markers, it was necessary to perform whole-genome amplification. Degenerate oligonucleotide-primed PCR (Nrich [Genetix]) (Telenius et al. 1992) performed better than multiple displacement amplification (Molecular Staging) (Dean et al. 2002) in early trials and, consequently, was used throughout.

We selected 44 binary markers in the present Y-haplogroup phylogeny (Y Chromosome Consortium [YCC] 2002; Jobling and Tyler-Smith 2003) that were predicted to be particularly informative in this study. These markers were typed using a combination of single-plex PCRs described elsewhere (Hurles et al. 2002; YCC 2002) and nine novel PCR multiplexes, each analyzing between three and seven SNPs. These multiplexes were designed to facilitate hierarchical typing, which minimizes the amount of genomic DNA required to define lineages at high resolution. These multiplexes use locus-specific primers tagged with universal primers to enable a two-step amplification protocol that equalizes the simultaneous amplification of multiple loci (Belgrader et al. 1996; Paracchini et al. 2002). SNPs lying within these PCR products were subsequently genotyped by single-base extension (SNaPshot [Applied Biosystems]) and capillary electrophoresis. Primer extension reactions were performed in half the recommended reaction volume but were otherwise processed in accordance with the manufacturer's instructions. The amplification and extension primers used in the present study are detailed in table 1.

Together, these markers define 41 Y-chromosomal lineages, of which 10 are found in the Malagasy, 16 are found within Island Southeast Asia and Oceania, and 8 are found in East African populations (Luis et al. 2004). The Y-chromosomal lineages in
East Africa are nonoverlapping with those found in Island Southeast Asia and Oceania (see fig. 1). As a consequence of this population differentiation, it is simple to apportion lineages found in the Malagasy to either an African or an Asian origin. All but two Malagasy lineages can be found in either East African or Southeast Asian populations. The two unaccounted-for lineages are single chromosomes belonging to haplogroups L* and R1b. Haplogroup L* is found at appreciable frequencies only in populations bordering the northern Indian Ocean, and haplogroup R1b reaches highest frequencies in northwestern Europe (Jobling and Tyler-Smith 2003). We believe these two lineages most likely reflect recent admixture events as a result of Indian Ocean trading links (Duplantier et al. 2002) and European colonization, respectively.

To identify which Island Southeast Asian or Oceanic population represents the most likely source population for the Asian lineages found in the Malagasy, we computed pairwise FST distances, using the Arlequin software, to determine the closest populations, in terms of genetic distance to the Malagasy. This analysis indicates that, among the populations we sampled, the two populations from Borneo are the best candidates for the likely source of these lineages (table 2). This genetic proximity between the Malagasy and Borneo populations reflects the presence of appreciable frequencies of lineages O1b and O2a* in both populations, as well as a relative lack of chromosomes belonging to O3 lineages. The
closest single Island Southeast Asian or Oceanic population to the Malagasy is that from Banjarmasin.

To explore the statistical significance of these observations, we devised a permutation test to assess whether the genetic distance between the Malagasy (A) and one population (B) is significantly smaller than that between the Malagasy and another population (C). In this test, the individual haplotypes observed in populations B and C are pooled and are randomly reassigned 10,000 times into two simulated populations (B' and C') with the same sample sizes as B and C. The P value of the difference in genetic distanceFST(A : B) - FST(A : C)is then calculated as the fraction of simulated population pairs in which the difference in genetic distance between each of the populations and the Malagasy is greater than that observed in the real data(FST[A : B'] - FST[A : C']) > (FST[A : B] - FST[A : C]). By use of this test, it was observed that there is no significant difference between the two Borneo populations (P = .8374) but that the resultant pooled Borneo population is significantly closer to the Malagasy than any other Island Southeast Asian population (P < .001). The phylogeny of mtDNA variation present in modern humans can be
crudely characterized as comprising L lineages, present almost exclusively in Africa, and M and N lineages, present almost exclusively outside of Africa. Thus, classifying mt genomes into these major clades has significant power for discriminating between African and Asian origins. We devised a novel multiplex using the single baseextension method described above to type seven coding-region base substitutions (transitions at positions 15043, 10400, 10398, 15301, 6455, 9824, and 10310) that define the M and N lineages, as well as the R9 sublineage within haplogroup N and the M7 sublineage within haplogroup M (Kivisild et al. 2002), both of which are known to be present in Island Southeast Asian populations (primers used in this multiplex assay are detailed in table 1). Among 37 Malagasy mt genomes, we found 23 that belong to M and N lineages and 14 that belong to L lineages (fig. 2 and table 3).

To further localize the geographical origins of Asian mtDNA lineages found in the Malagasy, we studied the hypervariable segment I (HVSI) sequence of the mt genome, for which a large volume of comparative data is available, we amplified and sequenced HVSI, using primers TTAACTCCACCATTAGCACC and GAGGATGGTGGTCAAGGGAC (Forster et al. 2002a) (between positions 16093 and 16362) in mtDNA from these 37 Malagasy individuals, and, by combining these data with the coding SNP haplotypes described above, we defined 14 distinct maternal lineages in the Malagasy (fig. 2).

A recently developed method for identifying the likely ancestry of a set of mt sequences is to perform a "center of gravity" (CoG) analysis of individual sequence types observed within a population (Röhl et al. 2001; Forster et al. 2002b). In our CoG analysis, the best matches to an HVSI sequence type were identified within a manually curated database of HVSI sequences associated with a precise geographical location. A CoG was then calculated by weighted interpolation of all best-match locations (see fig. 2). The relative lack of published Island Southeast Asian HVSI data could hamper a CoG analysis. To counteract this sampling bias, we added 82 HVSI sequences from Banjarmasin (n = 21), Kota Kinabalu (n = 36), and the Philippines (n = 25) to the analysis. These sequence types are given in table 3.
Exact matches within our database of 19,371 HVSI sequences can be found for all six maternal lineages in the Malagasy that appear to be Africa derived. By contrast, exact matches can be found for only three of eight Asia-derived maternal lineages.

The CoGs observed in the Malagasy
fall within either Island Southeast Asia or sub-Saharan Africa. These CoGs accord exactly with the lineage classifications: all sequence types that belong to L haplogroups are found in Africa, and all sequence types that belong to M and N haplogroups are found in Island Southeast Asia. The relatively broad distribution of the Asian CoGs suggests that the present level of geographical resolution afforded by a CoG analysis is not sufficient to enable us to identify a single likely source population in Island Southeast Asia. It does, however, allow us to exclude the possibility that a Pacific Island population was the sole source of these mt lineages.

We calculated Nei's gene diversity (using the Arlequin software) in HVSI sequences from the Malagasy and
compared it with diversity apparent in the three Island Southeast Asian populations described above, as well as in published data on Mozambique (Pereira et al. 2001) and Oceanic populations (Hurles et al. 2003b). The Malagasy appear to have diversity that is significantly lower than that seen in Island Southeast Asia and Mozambique populations(Pereira et al. 2001) but that is higher than that seen in Pacific islands colonized within the past 3,500 years (table 4).

The amount of genetic diversity observed in a population is heavily influenced by demography and thus gives insights into settlement patterns. We might expect that the presence of HVSI sequences from two diverse ancestral populations would inflate HVSI sequence diversity; however, the lower genetic diversity in the Malagasy compared with both ancestral populations
suggests either that early migrations were relatively restricted in numbers, duration, and origin or that subsequent population bottlenecks resulted in a postsettlement reduction of diversity. Recently colonized islands often exhibit reduced genetic diversity as a result of a combination offounder events and elevated genetic drift due to lower population sizes. However, this impact does not appear to be as severe in the Malagasy as it is for Pacific Island populations with a similarly recent settlement (reviewed by Hurles et al. [2003a]). This observation holds true even when only Asia-derived lineages are considered. This suggests that the sequential founder events and bottlenecks that were a feature of Pacific Island settlement were not paralleled in the colonization of Madagascar from the East and provides support for a direct rather than multistep process of migration from Indonesia. Alternatively, successive waves of migration from Asia may have brought different sets of lineages to Madagascar.

If we calculate gene diversity separately for Asia-derived and Africa-derived maternal lineages in the Malagasy, we find that
the Asian lineages are significantly more diverse. These observations are largely explained by the predominance of a single African HVSI sequence type(found in 9 of 14 Africa-derived mt lineages). This sequence type is found in all four Malagasy ethnic populations sampled in the present study, so its predominance does not result from genetic drift in a single Malagasy subpopulation. Intuitively, one might expect fewer founders and therefore lower genetic diversity from the more geographically distant ancestral population. However, this does not appear to be the case in this situation. Given that the diversity apparent within the two ancestral populations is comparable, this implies that migrations from Africa may have been more limited than those from Indonesia.

In principle, it would be interesting to test whether these differences in Africa-derived and Asia-derived lineage diversity are replicated in the paternal lineages of the Malagasy. However, it is well documented that estimates of diversity that are based on genotyping known SNPs are
biased by the markers selected for genotyping and the geographic distribution of the initial screening set used to identify these markers (Jobling and Tyler-Smith 2003). As a consequence, it is not appropriate to compare apparent SNP diversity between African and Asian Y-chromosomal lineages.

The above analyses demonstrate that we can consider the Malagasy to be an admixed population derived from two ancestral populations, one African and the other Indonesian; we can now estimate the admixture proportions of these populations. The mutual exclusivity of Y-chromosomal and mtDNA lineages between these two ancestral populations means that we can obtain a point estimate of admixture proportions simply by counting lineages.
Of Malagasy mtDNA lineages, 38% (14/37) can be traced to Africa, whereas 51% (18/35) of Y-chromosomal lineages have an African origin. This increases to 55% (18/33) when the two putative recently admixed Y chromosomes are removed.

When estimating admixture proportions, we are estimating the cumulative contributions made by different ancestral populations to a hybrid population (Chakraborty 1986). We do not know the true frequencies of the different lineages in these three populations at the time that admixture occurred, and we can only infer these frequencies from sampling the contemporary populations that best approximate these ancient populations. Various factors influence the accuracy and precision of estimates of admixture proportions from contemporary populations, including sampling errors, genetic drift in all populations, the degree of population differentiation between the ancestral populations, and mutations. Various statistical methods that take into account some of these factors are available for estimating admixture proportions (reviewed by Jobling et al. [2004]). Using the software LEADMIX (Wang 2003), we employed three different statistical methods to estimate the proportion of African ancestry in Malagasy paternal lineages; in order of increasing complexity, these estimators are RH62 (Roberts and Hiorns 1962), L91 (Long 1991), and W03 (Wang 2003), the last of which is a recently derived likelihood estimator that estimates rates of genetic drift simultaneously in the ancestral and hybrid populations. These three methods all gave very similar estimates of African admixture proportions, which do not differ greatly from the estimate obtained from lineage counting: 58% for RH62, 56% for L91, and 56% for W03. There are broad confidence limits (19%82%) for the latter likelihood estimate of paternal African admixture, which encompasses the point estimate of the proportion (38%) of African ancestry from maternal lineages. Consequently, the paternal and maternal estimates of the proportion of African ancestry in the Malagasy are statistically indistinguishable;
there is no evidence of ancient sex-biased admixture. Further microgeographic sampling within Madagascar will be required to explore how admixture proportions vary among different Malagasy ethnic populations.

Characterization of genetic ancestry in the Malagasy has hitherto remained partial and imprecise. By contrast, in this study, because we generated comparative data from a wide range of potential ancestral populations, we have been able to identify the likely origins of all paternal and maternal lineages found in four different Malagasy ethnic populations.

We have confirmed the presence of the mt
"Polynesian motif" among maternal Malagasy lineages, as was reported elsewhere (Soodyall et al. 1995). However, direct migration from Polynesia can be discounted, since the predominant Y-chromosomal haplogroups found in Polynesians, O3 and C, are not found at all among Malagasy paternal lineages.

Among the 10 potential ancestral populations in Island Southeast Asia and Oceania that we sampled, the Borneo populations had Y-chromosomal haplogroup distributions that were the most similar to those observed among the Malagasy. This observation is in striking agreement with the linguistic evidence that the Malagasy language is most closely related to the Maanyan language from the Barito River Valley in southern Borneo. Now that we have identified the region of origin for this Asian migration to Madagascar, further microgeographic sampling within Indonesian islands may pinpoint more precisely the origins of the Malagasy. Populations that possess both the paternal (e.g., O1b and O2a*) and maternal lineages (e.g., Polynesian motif) that are common in the Malagasy would be of particular interest. It is intriguing that the
majority of Asia-derived mtDNA types present in the Malagasy do not have exact matches in an extensive database of HVSI sequences, and identification of these specific mtDNA sequence motifs within potential ancestral populations in Indonesia should be a priority. However, it must be remembered that genetic diversity in contemporary populations is an imperfect proxy for variation within ancient populations. The ongoing processes of population fission and fusion as well as genetic drift may prohibit the identification of a precise contemporary population that exactly represents the ancient population from which migrants departed. In addition, the possibility remains that migration either occurred from several genetically distinct sources within Indonesia or was kin structured (Fix 1999), such that no ancient population ever had the same lineage distribution as that of the migrants to Madagascar.

Admixture between two highly differentiated populations generates long-range allelic associations that decay over time (Chakraborty and Weiss 1988). The amount of linkage disequilibrium (LD) exhibited by an admixed population depends on a number of factors, including proportions of admixture, differentiation between ancestral populations, time since admixture, and demography (Pfaff et al. 2001). It has been proposed that it will be possible to efficiently map genes underlying complex traits by focusing on association studies in admixed populations, and a range of potentially informative populations has been identified (Halder and Shriver 2003). Although the time since admixture in the Malagasy is comparatively long, the high degree of differentiation between the two ancestral populations and the even balance of their contributions suggest that
excess LD might still exist. Admixture mapping of genes underlying complex traits is predicated on the observation that the trait itself is differentially manifested among the ancestral populations. Therefore, although most attention has focused on European and African admixture in African Americans (Halder and Shriver 2003), it would be of interest to identify a range of admixed populations that are derived from various different ancestral combinations. The admixture of Indonesian and African lineages present in the Malagasy may be uniquely informative. Further characterization of LD in the Malagasy will be necessary for determining whether the Malagasy can be added to the list of admixed populations suitable for the identification of genes underlying complex traits that are of interest to anthropologists and medical geneticists alike.

Recap from above:

It is intriguing that the majority of Asia-derived mtDNA types present in the Malagasy do not have exact matches in an extensive database of HVSI sequences, and identification of these specific mtDNA sequence motifs within potential ancestral populations in Indonesia should be a priority.

In the Malagasy haplogroup mapping provided by the authors of the study, the typical African markers of interest are: B*(xB2b), B2b, E2b & E3a. Total African out of 33 between the African MRCA lineages and the Asian counterparts, is 18/33, leaving the Asian MRCA lineages to 15/33.

E3a seems to be relatively significant in the African contribution!

Other lineages — which are generally labeled as "Asian" within circles of geneticists — to be noted are: J, L*, O1b & O2a*.

*Unedited* extracts from Metmuseum.org:

Timelines of East and South Africa from 1st century to the 17th:

• 1st–7th century The kingdom of Aksum originates as an urban center founded by Ge'ez-speaking people and situated in the highlands of Ethiopia, later growing to encompass much of modern-day Ethiopia and Eritrea and even conquering distant southern Yemen for a time. With access to the lucrative Red Sea trade through Adulis, its port city, Aksum becomes an important link in the network extending from the Roman empire to India. In 270 A.D., Aksum begins minting its own gold coins to facilitate international trade, following the model of Roman coinage. These coins provide visual evidence of a far-reaching religious and cultural shift that occurs in 330, when the Aksumite ruler Ezana (r. 320–50 A.D.) converts to Christianity; previously bearing a southern Arabian disk and crescent, coins are thereafter imprinted with the Christian cross. Ezana's conversion may have reflected his desire to cement relations with the Greek-speaking world of the Mediterranean; the influence of Greek culture is shown in the inclusion of Greek inscriptions alongside those in Ge'ez on Aksumite monuments of the period. Aksum declines in the seventh century, when Islamic Persians take control of the trade routes upon which it depends, but its Christian legacy remains vital in Ethiopia to the present day. Aksum is now principally known for the monolithic stelae erected at its capital city during the third and fourth centuries.

• ca. 500 The Lydenburg heads, a group of seven ancient fired earthenware heads found in the Transvaal of South Africa and named after the site where they were discovered, are buried in a manner suggesting careful deliberation. While their meaning is unclear—they may have been used in masquerades as part of initiation rites—the heads remain the most impressive works of Early Iron Age art yet discovered in the southern regions of the African continent.

• 8th–9th century Trade brings Arab merchants to the East African coast. Gradually this trade leads to the formation of settlements (which are nevertheless primarily African communities) and intermarriage with local African populations, giving rise to the Swahili Coast Culture. Exports include ivory, slaves, ambergris, and gold. Zanzibar eventually develops as a slave warehouse.

• 8th–9th century The site of Kilwa on the coast of modern-day Tanzania is first occupied. Originally a fishing and weaving community that may have traded with interior settlements, Kilwa later develops into one of the most important trading centers on the Swahili coast. Ivory is probably a major item of trade, exchanged for ceramics brought from the Persian Gulf by Arab merchants. Locally minted silver and copper coins, dated between 980 and 1100, are found on Pemba Island.

• ca. mid-9th century Late Iron Age sites such as K2 (Bambandyanalo) emerge in the Limpopo River valley, as well as the earliest walled settlements to appear on the Zimbabwean plateau. Goods such as imported glass beads found at both centers indicate the existence of trade with the eastern coast of Africa. Abundant tools and ivory ornaments found at K2 point to a thriving ivory-working industry. The K2 community declines in the mid-eleventh century with Mapungubwe's rise to power.

• ca. 1050–1270 The settlement of Mapungubwe, located in the Limpopo River valley of present-day Zimbabwe, is supported by an economy based on livestock and trade. By controlling the flow of cattle and goods such as ivory, rhinoceros horn, and gold, the elite of Mapungubwe create status divisions that are reinforced with visual metaphors. Living atop the hill on which the site was founded, they remove themselves from the rest of the community behind monumental walls. Ivory hunting, copper mining, and trade in gold are important activities of the Mapungubwe rulers. Craftsmen develop the art of metalwork, particularly gold, creating gold bangles, beads, and, most notably, gold-plated rhinoceros sculptures. Engaged in commerce with the Swahili coast, traders from Mapungubwe exchange their goods for glass beads, cloth, and Chinese celadon. The city is abandoned shortly after Great Zimbabwe's rise to prominence in the thirteenth century.

• ca. 12th–13th century At the site in Ethiopia now called Lalibela (after the ruler Lalibela, r. late twelfth–early thirteenth century), a group of churches are carved directly from the rock of the Lasta Mountains under the auspices of the Zagwe dynasty. Like the monuments and tombs of Aksum, these buildings are carved to look as though they were conventionally built from assembled materials, but in fact are hewn from unified masses of stone. This complex of eleven churches, originally called Roha (Arabic for Edessa, a reference to the city blessed by Christ), evokes multiple sites intended to associate the Zagwes with strong religious and political predecessors. In addition to being a new incarnation of Edessa, with all the divine favor implied by that status, Lalibela is intended to represent a new Jerusalem. Areas within the Lalibela complex replicate the names of holy sites such as the church of Golgotha, strengthening these associations with visual cues. The Church of the Redeemer, for example, makes explicit political reference to Aksum, quoting the architectural structure of Aksum's famous cathedral, Saint Mary of Zion. After becoming associated with the Ethiopian saint Lalibela in the early fifteenth century, Lalibela's meaning shifts and the complex develops into a thriving pilgrimage center.

• ca. 1250–1450 Great Zimbabwe is founded by Bantu-speaking ancestors of the Shona people. Like its predecessor Mapungubwe, Great Zimbabwe's economy is based on cattle and supplemented by trade. The city utilizes the stone wall of the plateau region on a scale never equaled thereafter. The sinuous, massive walls of its complexes reach a height of thirty-six feet in some areas, constructed entirely without mortar from slabs of stone. These walls adjoin clay and wattle huts to form elaborate courtyards intended to house the ruling elite. Beyond architecture, Great Zimbabwe produces little in the way of visual art, with one significant exception: the soapstone birds combining human and animal features, which are later adopted as national symbols (one currently adorns the flag of Zimbabwe).

• ca. 13th century The Swahili culture, reflecting the settlement of Muslim Arab merchants along the eastern coast and their intermixture with local East African peoples, becomes well established in powerful trading centers. The rise of the Swahili town of Kilwa coincides with the ascendance of Great Zimbabwe, which supplies Kilwa with ivory, gold, and food.

• ca. 13th century The first stages of the Great Mosque of Kilwa and the secular palace complex of Husuni Kubwa are erected in what is now Tanzania. These buildings, constructed of local coral blocks, represent the first and finest flowering of Swahili architecture. Although stylistic influences can be traced to sources as disparate as Arabia and India, the synthesis achieved here is distinct to the Swahili coast.

•300 B.C.–16th century A.D. The Bantu migration from the Cameroon-Gabon area to the coasts of East and South Africa concludes. Among other things, Bantu-speaking peoples introduce iron technology to the region.

• 1270–1530 The Early Solomonic period in Ethiopia is one of increased prosperity due to both political stability and Ethiopia's central location along several pivotal trade routes crossing sub-Saharan Africa and extending into Asia. The centralized monarchical leadership commissions the construction of lavishly decorated and painted rock-hewn royal churches, importing artisans and materials from around the world. Monasteries, attended by Ethiopia's nobility, are established as centers of artistic and scholarly learning and production.

• 13th–16th century The rise of the prosperous coastal towns of Mombasa, Malindi, and Kilwa (in present-day Mozambique, Tanzania, and Kenya) is the result of Islamic immigration from the northwest and the establishment of trading networks across the Indian Ocean. Gold, slaves, and ivory are traded for cloth, beads, metal goods, silks, and porcelain. Arabic colonies, of the type established at Gedi (near Malindi) on the Kenya coast from the fourteenth to sixteenth century, often include a palace, several mosques, and tall stone houses for nobility. Construction is usually completed in coral slag, with stone reserved for the ornate detailing around doors and windows.

• 1434–1468 Emperor Zar'a Ya'eqob of Ethiopia mandates the reading of the Miracles of the Virgin Mary, thus establishing Mary as a primary visual and liturgical icon in the Ethiopian practice of Christianity. The court painter Fre Seyon (1434–1468) gives visual expression to Emperor Zar'a Ya'eqob's sacred poetry about the Virgin, reflecting the emperor's interpretation of her as a sensitive and forgiving mother.

• 1488 The first Portuguese explorers land in South Africa, stopping to restock water and food and to repair their ships, setting a precedent that will continue for the next 150 years. In the sixteenth and seventeenth centuries, as more traders take the southern route from Europe to India, the colony of Cape Town is established as an important stopover along what is often more than a year-long voyage.

• 1498 The Portuguese reach the Swahili coast, finding an established, sophisticated network of intercontinental commerce as well as several sizable prosperous cities.

• 1505–1650 With the support of Portuguese royalty and under the auspices of a Christian brigade against Islam, the Portuguese establish military forts from which they attack and destroy several large cities—including Kilwa (Tanzania) and Mombasa (Kenya)—and attempt to dominate the Indian Ocean trade. Revolts among the local populations in Mozambique and Kenya meet with differing levels of success. Additionally, important military alliances against the Portuguese are established between Islamic traders. Besides the introduction of several food products, including cassava, maize, and the tomato, the Portuguese have a minimal impact on the cultures of East and South Africa.

• 1527–1543 Islamic jihads against Christian Ethiopians by the neighboring kingdom of Adal destroy many of Ethiopia's churches, libraries, and monasteries, causing the loss of centuries of invaluable records.

• 1593 The Portuguese build Fort Jesus at the entrance to Mombasa harbor, allowing them to sack and plunder the city, destroying much of the Islamic architecture.

• 16th century–ca. 1650 The Torwa state (also called Butwa), which appears to be an outgrowth of the Great Zimbabwe culture, continues the region's tradition of monumental stone architecture. Mortarless walls composed of shaped and fitted stones are found at sites in Matendere, Khami, and Danangombe.

•16th–17th century The Mutapa state, located south of the Zambezi River in present-day Mozambique and Zimbabwe, emerges as an important regional power controlling trade routes from the interior of southern central Africa to the coast. Gold, silver, and ivory, as well as locally produced cloth, are exchanged at the coast for silks, ceramics, and other goods of foreign origin.
...

Shifting back to western Africa momentarily...

BEFORE OUR ANCESTORS

The heads have yet to be accurately dated but similar stones in Senegal date back as far as 2,000 years.

(click to enlarge)

``No one knows what role the heads played in ancient times,'' Niangoran-Bouah said.

``They are not the work of men known to us or our ancestors,'' said Ta-bi-Tra, a hunter at Gohitafla, now inhabited by Ivorian President Henri Konan Bedie's ruling Baoule tribe. Baoule warriors arrived there under Queen Abla Pokou in the 17th century, displacing Gouro tribes who in turn had pushed out the Wan culture in the 15th century.

``The Wan consider them to be ancestral objects,'' said Niangoran-Bouah, citing the stories of nearby Wan descendants, including a theory that the heads betrayed them to the enemy.

The heads are also seen as grave charms for Wan warriors, homes for dead mens' souls or guardian spirits and talismans.

``We make offerings for a safe voyage, to find a good partner or fight off evil sorcerers, eaters of souls, jealous people and poisoners,'' said one soothsayer. ``We trust them.''

Animal sacrifices in cult rituals ensured successful childbirth and stone heads still play a part in ritual exorcisms and purification of adulterers. One man described being inhabited by a spirit from stones surrounding his house. ``I have 13 children, they all come from the stones.''

Prehistoric stone heads have been found around the world, from Africa to Europe and America. Marahoue's are thought to be among the largest and oldest along Africa's Atlantic coast.

Ivorian standing stones are larger than average and found deeper in the ground than similar African examples, suggesting a greater age of up to 7,000 years, Niangoran-Bouah said.

Such African megaliths weighing between half a ton and 15 tons are found in a northwestern strip on the Mediterranean and pockets in a wide west-east sub-Saharan band between Senegal and Kenya. Villagers showed Reuters a 19-foot rock said to be one of the largest African megaliths.

In Mali, to the north, anthropologists have been baffled by the Dogon culture's ability to predict cycles of an invisible satellite of the star Sirius, which appears every 60 years. The Dogon, whose God Amma is said to have thrown a ball of clay into space to create Earth, is just one example of deep civilization in Africa often brushed over by colonists.

``This civilization before the pre-colonial period honorsour country,'' Niangoran-Bouah said. ``During colonial times the stones were probably kept hidden in the forest. The whites did not see them.''

That, for better or worse, is no longer the case.


Source: http://www.iol.ie/~afifi/BICNews/History/history1.htm

"The problem is that West Africa's tropical climate means clues to history often rot, leaving only rich oral tradition."

In the meantime, going southward, and unedited from metmuseum.org!...

c.1000 BC - 1st AD

Game Pass Shelter
Kwazulu-Natal
South Africa
Courtesy of the Rock Art Research Institute, University of the Witwatersrand, South Africa
RSA GAM 106 2A


Game Pass Shelter
Kwazulu-Natal
South Africa
Courtesy of the Rock Art Research Institute, University of the Witwatersrand, South Africa
RSA GAM 95


African Rock Art: Game Pass

High in a secluded valley in the Drakensberg Mountains is the spectacular site of Game Pass. Here, on the walls of a narrow sandstone shelter, are painted a great many images of eland (the largest of all antelopes). For a shelter so open to the elements, the paintings are miraculously well preserved and in some places the brush marks can still be seen. Situated among the many images of eland are smaller human figures in running postures. This site, however, is most famous for a cluster of images tucked away on one side of the shelter. It was extensive analysis of these images that first led scholars to the realization that the art was a system of metaphors closely associated with San shamanistic religion.

This cluster of images is comprised of an eland with closely associated anthropomorphic figures. The eland's head is lowered, turned toward the viewer with staring hollow eyes. Its one front leg bends under its weight, while its two back legs are crossed over as it stumbles, and the hair on its neck and dewlap is erect. This sort of behavior is characteristic of eland when they have been wounded by one of the poisoned arrows that the San use to hunt. They stumble about, their heads sway loosely from side to side, they sweat profusely and even bleed from the mouth and nose, and the hair along their neck and back stands erect. This image, then, is of an eland in its final death throes.

Behind the eland, a human figure holds the tail of the animal; this figure's legs are also crossed, mimicking those of the eland's back legs. This human figure's legs continue all the way underneath the rock shelf, and close inspection reveals that the figure does not have feet but antelope hooves. Next to this figure are two more in similar pigment. The first is of a human figure bending forward with one arm stretched out behind its back. It apparently has no head—although the pigment may have worn away—and a short skin-cloak, known as a kaross, falls from the chest. Just above and to the right of this figure is one with an animal head, wearing a full kaross. To the right, in an orange pigment, is another human figure with an arm behind its back. This figure too, like the one clutching the eland's tail, has antelope hooves instead of feet and its hairs are erect like those on the eland itself. The arms-back posture—adopted by contemporary San at dances in the Kalahari Desert of Namibia and Botswana when they ask God to infuse them with supernatural energy—is frequently depicted in San art. Bending forward is closely related to the arms-back position and is adopted by dancers when the supernatural energy begins to "boil" in their stomachs. These three human-animal figures suggest a close association between the dying eland and the ecstatic experience of dancers.

Indeed, in the Kalahari, the San often like to perform a trance dance around or near the carcass of a freshly killed eland in order to harness supernatural energy (known as n/om) from the animal. When they have harnessed this energy, they enter an altered state of consciousness in which they stumble about, sweat profusely, and the hair on their bodies stands on end. So closely are the experiences of trance and the death of eland in their physical manifestation that the San talk about trance as "the death that kills us all." They speak of their experience metaphorically; for them, there is no difference between death and trance.

The link between the dying eland and the human figure clutching its tail in this cluster of images is a graphic metaphor—an allusion to the close parallels between death and trance. Once this metaphor was identified at this site, a new vista opened up for scholars, and many other religious metaphors and symbols were identified in San art. It is for this reason that the site is often referred to as the Rosetta Stone of southern African rock art.

A line drawing illustrating figures as they appear on the so-called Rosetta Stone.

- by Geoffrey Blundell, Origins Centre, University of the Witwatersrand, Johannesburg, South Africa. Images and content courtesy of metmuseum.org.

• 172–175 A.D. The Moors from northern Africa invade Spain.

Under Roman control, the Iberian Peninsula prospers commercially and politically in the first and second centuries A.D., until the Moors attack from North Africa in the latter part of the second century. - Courtesy metmuseum.org

Not much else is said about the outcome of this invasion.

And as more studies come out, our knowledge on the genetic impact in the region expands as well…

“The medieval Priego sample showed greater affinities to North-Africa than other Iberian Peninsula samples including that of present day Priego. Haplotype analysis revealed that some African haplotypes detected in Medieval Priego have matches with samples of precise north African origin as Tunisia, west-Sahara or the Canary Islands point to well documented historic connections with this area. However, medieval Priego L1b lineages carrying the 16175 transition have their most related counterparts in Europe instead of Africa. The coalescence age for these L1b lineages is compatible with a minor prehistoric African influence on Priego that also reached other European areas.” - A. Gonzalez et al., 2006

L1b lineages here therefore are more likely to be pre-historic African gene flow directly into Europe. Not the first time lineages generally restricted to Africans have made their way into Europe directly, in addition to paternal lineages like E3b and E3a; For instance, upon coming across the old African lineage of Hg A, as well as E1 in Portuguese samples without any E3a detection, a lineage quite frequent in west Africa, had compelled Goncalves et al. to strongly suggest a likely pre-historic direct arrival of these lineages into southwestern Europe from Africa. Is it possible that these arrived with the likes of L1b, amongst others mtDNA? Worth pondering.

More timeline - Courtesy metmuseum.org…

•711–718 An army of Arabs and Berbers, unified under the aegis of the Islamic Umayyad caliphate in Damascus, lands on the Iberian Peninsula and, through diplomacy and warfare, brings the entire peninsula—except for Galicia and Asturias in the far north—under Islamic control. The Visigothic leadership is forced out of Toledo, but a large Christian population remains under Muslim rule. In 718, a Christian kingdom is formed in the Asturian region, the northern part of the peninsula beyond the Duero River. The new Muslim territories, called al-Andalus, are administered by a provincial government centered in Córdoba…

At the beginning of the period 1000 to 1400, the Umayyad caliphate collapses, fragmenting Islamic power in the Iberian Peninsula. Christian kingdoms in the north gradually unite, become much more powerful, and expand their territories through a campaign of reconquista (reconquest). Despite the weakening of Islamic power, its influence in science, medicine, and art is extraordinary and contributes to the rich diversity of the peninsula as Christians, Muslims, and Jews live peacefully together. By the end of the period, the Christian kings conquer virtually all of Muslim al-Andalus, leaving Granada and the surrounding territory as the last bastion of Islamic Iberia.

•1085–1145 The Almoravids, a newly emerged Islamic power in North Africa, enter al-Andalus after the fall of Toledo in 1085 in response to the Ta’ifa leaders' plea for help in repelling the Christian armies of northern Spain. The Almoravids assume control of al-Andalus in 1090, while maintaining their primary seat of government in Marrakesh (Morocco). Although they begin by sponsoring austere programs of architectural decoration, their later monuments and textile manufactory in Almería indicate that the Almoravids eventually embrace the luxury culture of al-Andalus.

•1090s Count Raymond II of Burgundy (r. 1087–1107), son-in-law of King Alfonso VI of León, repopulates the once-Roman town of Ávila situated between Christian and Muslim territories.Construction begins on the city walls and continues after the Muslim raid of 1109. Twelve meters high, 3 meters thick, and 2.5 kilometers long, the Ávila walls are the best preserved from medieval Europe.

•1100–1200 Despite the strict Islamic rule of the Almoravids and Almohads, who adhere to the conservative Malikiyya school of Sunni Islam, this period is a high point in the intellectual, philosophical, and scientific life of the Iberian Peninsula. Key figures include Ibn Rushd (known in Christian Europe as Averroës, 1126–1198), one of the greatest Islamic philosophers, and Moses Maimonides (1135–1204), possibly the greatest figure of medieval Judaism. The Latin translations of their works have a profound impact on the development of philosophy and science in Europe…

Although they began by sponsoring austere programs of architectural decoration, their later monuments and textile manufactory in Almería indicate that the Almoravids eventually succumbed to the luxury culture of al-Andalus. Especially spectacular from this period is the minbar from the Kutubiyya Mosque, Marrakesh, commissioned in 1137 by the last Almoravid sultan, cAli ibn Yusuf (r. 1106–42), for his congregational mosque. In North Africa, the mosques of Algiers (ca. 1097), Tlemcen (1136), and Qarawiyin in Fez (1135) are important architectural examples from this period.

•1143 The Portuguese nobility under the leadership of Afonso Henriques gains independence in a treaty formally ratified in 1179. The Portuguese rapidly push the Muslims back into Spain, aided by Crusaders who are on their way to the Holy Land. Portugal then becomes an important Atlantic sea power exporting tin and silver.

•1145–1232 The Almohads, another Berber dynasty from the southern Maghrib, supplant the Almoravids and take Sevilla, Córdoba, Badajoz, and Almería. The Almohads make Sevilla their capital in al-Andalus, while retaining Marrakesh as their center of power in North Africa. The Great Mosque and the minaret called La Giralda, which they build in Sevilla, are paradigms of Almohad style…

In the mid-twelfth century, the Almoravids were replaced by the Almohads (al-Muwahhidun, 1150–1269), a new Berber dynasty from North Africa. By 1150, the Almohads had taken Morocco as well as Sevilla, Córdoba, Badajoz, and Almería in the Iberian Peninsula. The Almohads made Sevilla their capital in al-Andalus, while retaining Marrakesh as their center of power in North Africa. Following the Almohad defeat by the combined armies of Aragon and Castile at the Battle of Las Navas de Tolosa in 1212, a turning point in the peninsula's history, al-Andalus once again fractured into tribute-paying principalities, vulnerable to the depredations of Christian kingdoms. These principalities, except for Nasrid-ruled Granada, soon lost their sovereignty.

As religious reformation was integral to the Almohad establishment, their courts in Marrakesh and Sevilla became centers of Islamic learning. In Almohad arts, a rigorous style saw the increasing schematization of ornament and the continued use of geometric design. The Great Mosque and the minaret called La Giralda, which they built in Sevilla, are paradigms of Almohad style. In North Africa, architectural developments included the walls of Fez, Rabat, and Marrakesh and the mosques of Taza (1142), the Kutubiyya (Marrakesh, 1147–58), Tinmal (1153–54), the Qasba (Marrakesh, 1195), and Hasan (Rabat, 1199; unfinished).

•1212 The combined armies of Aragon and Castile defeat the Almohads at the Battle of Las Navas de Tolosa, a turning point in the peninsula's history. Al-Andalus fractures into tribute-paying principalities, vulnerable to invasion by the Christian kingdoms. These principalities, except for Nasrid-ruled Granada, soon lose their sovereignty.

•1232–1492 The Nasrid dynasty rules Granada and neighboring Jaén, Almería, and Málaga in southern Spain. The early period of Nasrid rule is characterized by insistent pressure from Christian armies from the north, which successfully conquer Valencia, Játiva, and Jaén and make the Nasrids tribute-paying vassals in 1243. The Nasrids form tentative alliances with the Marinids of the Maghrib and keep uneasy peace with their Christian overlords. Nasrid arts grow from Almohad traditions but display more variety and richness than their precursors.

•1300–1400 In the thirteenth and fourteenth century, urban populations increase in Iberia as people flock to the towns in search of new opportunities. Castile becomes famous for its wool, and gold florins start to be minted. Before this, silver coinage was standard except in Muslim al-Andalus, where gold coinage had been in use for a long time. Wool, iron, and wine are among the most important exports at this time.

•1300–1400 During the fourteenth century, the Nasrid sultans commission and decorate splendid palaces, of which the Alhambra, the last major Islamic monument of Spain, is their greatest work. Built by a succession of Nasrid rulers, the Alhambra is conceived as a powerful image for a monarchy, a vast stage set for a diminishing power of the last Muslim rule on the peninsula.

• ca.1400–1492 The artistic traditions of Islamic Spain continue under Nasrid patronage, even though the period is marked by internal strife and marred by the gradual erosion of the kingdom. By mid-century, much of Nasrid territory is under Christian control, and in 1492, following a ten-year onslaught, Granada falls to the forces of Ferdinand and Isabella, bringing to an end almost 800 years of Islamic presence on the Iberian Peninsula… 

The Nasrids formed tentative alliances with the Marinids of the Maghrib and kept uneasy peace with their Christian overlords. Despite its precarious political situation, for over two and a half centuries Granada served as a great cultural center of the Muslim West, attracting leading scholars and literati of the day. Severe political crises in the Maghrib in the fifteenth century, combined with the union of the Christian kingdoms of Castile and Aragon through the marriage in 1469 of Ferdinand and Isabella, whose avowed mission was the expulsion of the Muslims from the Iberian Peninsula, proved to be the downfall of the Nasrids. The last Nasrid ruler, Muhammad XII (called Boabdil by Spanish historians), was exiled to the Maghrib on January 2, 1492. The termination of Nasrid rule also brought to an end almost 800 years of an Islamic presence on the Iberian Peninsula.

During the fourteenth century, the Nasrid sultans dedicated themselves to the decoration of their splendid palaces. Their most singular artistic achievement was the famous Alhambra (al-qalca al-hamra), or the red castle, so-called perhaps because of the color of the walls and towers that surround the citadel. Situated on a hill overlooking Granada, the Alhambra was conceived as more than a well-fortified palace—it was a royal city. The creation of a succession of Nasrid rulers, in particular Ismacil I (r. 1314–25), Yusuf I (r. 1333–54), and Muhammad V (r. 1354–59, 1362–91), the Alhambra was a powerful image for a waning monarchy, a vast stage set for the diminishing power of the last Muslim rule on the peninsula. Work on the palace-city continued for nearly two centuries; the resulting architectural complex, with its intricate succession of rooms and courts, its rich interior facades, and its numerous gardens, fountains, and watercourses, is one of the most magnificent examples of Islamic architecture. 

Nasrid arts grew from Almohad traditions but displayed far more variety and splendor than their precursors. Textiles recall the rich interior settings of the Alhambra. Also important are ceramics overglaze-decorated in luster, a technique dating back to ninth-century Iraq and dispersed to many parts of the Islamic world. Initially lusterware was manufactured in Málaga, Murcia, Almería, and possibly Granada, but by the fifteenth century, Manises, near Valencia, supplanted Málaga as the main center of luster production. These Spanish luster-painted wares, whether produced under Muslim or Christian patronage, had an important impact on the ceramic industry of Italy, where they gave rise to the development of maiolica. The finest military arts that survive from al-Andalus are also from this period; the Nasrid's luxury arms, which were probably never used in battle, offer examples of a rich craft used to support a public image.

Elsewhere…

"Islamicized Africans (Moors) invade Spain, and rule it unti1 1492. The Moors brought agriculture, engineering, mining, industry, manufacturing, architecture, and scholarship, developing Spain into the center for culture and learning throughout Europe for almost 800 years until the fall of Granada in 1492."

Source:http://web.cocc.edu/cagatucci/classes/hum211/timelines/htimeline2.htm

Possibly the earliest indicator of Prosthetic technology...

ca. 1295 & 664 BC In the Nile Valley:

The "Cairo toe" appears to have been functional

Cairo toe earliest fake body bit

An artificial big toe found on the foot of an ancient Egyptian mummy could be the world's earliest functional fake body part, UK experts believe.

A Manchester University team hope to prove that the leather and wood "Cairo toe" not only looked the part but also helped its owner walk.

They will test a replica in volunteers whose right big toe is missing.

If true, the to will predate the currently considered earliest practical prosthesis - a fake leg from 300BC.

The Roman Capua Leg, made of bronze, was held at the Royal College of Surgeons in London but was destroyed by Luftwaffe bombs during the Second World War.

Lead researcher Jacky Finch said: "The toe dates from between 1069 and 664BC, so if we can prove it was functional then we will have pushed back prosthetic medicine by as much as 700 years."

Colleagues at the University of Salford will also be testing a second, even older ancient Egyptian big toe which is currently on display at the British Museum.

This artefact, from between 1295 and 664BC, is made from cartonnage, a kind of papier-mâché made from linen, glue and plaster.

Like the Cairo toe, this too shows signs of wear, suggesting that it was worn by its owner in life and not simply attached to the foot during mummification for religious or ritualistic reasons.

However, unlike the Cairo toe, it does not bend, suggesting it may have been more cosmetic.

Jacky Finch said: "The Cairo toe is the most likely of the two to be functional as it is articulated and shows signs of wear.

"It is still attached to the foot of the mummy of a female between 50 and 60 years of age. The amputation site is also well healed."

The Cairo toe is on display at the Cairo Museum in Egypt.


Source: BBC

c. 164,000 year ago:

Early use of Makeup in Africa

In one of the earliest hints of "modern" living, humans 164,000 years ago put on primitive makeup and hit the seashore for steaming mussels, new archaeological finds show.

Call it a beach party for early man. But it's a beach party thrown by people who weren't supposed to be advanced enough for this type of behavior. What was found in a cave in South Africa may change how scientists believe Homo sapiens marched into modernity.

Instead of undergoing a revolution into modern living about 40,000 to 70,000 years ago, as commonly thought, man may have become modern in stuttering fits and starts, or through a long slow march that began even earlier. At least that's the case being made in a study appearing in the journal Nature on Thursday.

Researchers found three hallmarks of modern life at Pinnacle Point overlooking the Indian Ocean near South Africa's Mossel Bay: harvested and cooked seafood, reddish pigment from ground rocks, and early tiny blade technology. Scientific optical dating techniques show that these hallmarks were from 164,000 years ago, plus or minus 12,000 years.


Source: Link

...or it could be that when concepts of using jewelry, makeup, 'symbolic' art, burying the dead [particularly elaborate burials] and so forth emerged, tendencies towards "modern behavior" were already inherent in anatomically modern humans...as such, as a trait of modern humans, there would be no such thing as going back to being 'not behaviorally modern'; 'necessasity' usually molds humans' lives and associated creativity under a given set environmental conditions both spatially and temporally. But let's consider the following, for instance:

...But what about the origins of the artefactual remains that are taken to reflect 'modern behaviour'? What seems to underpin the manufacture of decorated and ornamental objects and of graphic designs and forms is an ability to think (and talk?) symbolically, to develop a set of material forms that are conventionally used to represent otherwise intangible concepts, among them personal identity and ownership. - By John Parkington and Cedric Poggenpoe, Precocious Human Behaviour in South African Prehistory

For more reading on the "Behaviorally Modern" concept,  go here: Link

Consider the archaeological indications that the Neanderthals buried their dead, as did anatomically modern Humans, although later on human burials [not of the Neanderthals and like upright hominids, but that of anatomically modern humans] began to reveal containment of *grave goods*, presumably to be used by the dead in another life - perhaps a sign of sophistication in spiritual thinking so to speak (See notes from Donald Johanson for example).

Between c. 400,000 and 200,000 years BP:

Jerome M. Eisenberg, Ph.D. and Dr Sean Kingsley

Now, from the remote shores of Budrinna on Lake Fezzan in Libya, and Melka Konture on the banks of the River Awash in Ethiopia, a series of stunning discoveries are set to challenge the originality of the Neolithic Revolution. After 39 years of surveys and excavations, Professor Helmut Ziegert of Hamburg University presents his results as a world exclusive in Minerva (pp. 8-9). In both African locations he has discovered huts and sedentary village life dating betweenan astonishing 400,000 and 200,000 Before Present - if correct, literally a quantum leap in our understanding of man's evolution.

Interesting development; possibly marks the beginning of an era ushering in some breaking away from or loosening of the traditional Eurocentric doctrine in scholarly circles of trying to make every supposed "unprecedented turning point in human biological and social evolutionary histories" into the monopoly of what they consider "non-Africans", as though throughout much of anatomically modern human's (a.m.h) pre-OOA history, which essentially makes up a substantial portion of a.m.h's bio-history, and those of his Homo genus counterparts in continental Africa, nothing of note occurred in such extended period of time for some reason until after they emigrated from the continent. Instead, in such warped traditional Eurocentric thinking, the norm has been to present Africans as recepients of the fruits of such "turning points", as opposed to being agents of laying down the foundations for such, which archaeological finds make more and more apparent.

Archaeological indicators of African-South Asian contact by ~ 4000 BC: Botanical and Artifactual indicators based on B. Julius Lejju et al.’s work…

Introduction of Bananas into Africa

Given the evidence for early domestication of bananas in New Guinea by the early 5th millennium BC, it would seem to be within the bounds of possibility for bananas to have reached Uganda by the mid to late 4th millennium BC, particularly if these were AA or AAA cultivars brought directly from southeast Asia. This would imply arrival of the plant on the east African coast long before the date of about 1000 BC suggested as a terminus ante quem by De Langhe et al. However, such an early arrival would also seem to be contradicted by the linguistic evidence linking the diepersal of bananas across Africa with Bantu languages, whose antiquity is not usually deemed to extend back as early as the 4th millennum BC…

…From these beginnings a remarkable diversity of banana cultivars arose as a result of human intervention, since banana plants cannot propagate by natural means. This diversity is particularly well represented among the AAB plantains in the rainforest regions of Africa, with at least 115 known cultivars. While this implies a long history of cultivation and experimentation within Africa, it is also likely that bananas may have been introduced to Africa several times. AA and AAA cultivars may have been introduced directly from southeast Asia, whereas AAB and ABB hybrids are more likely to have reached Africa from India or Sri Lanka. Thus, it is unfortunate that we cannot yet identify different banana genomes from their Phyloliths.

It has been suggested that the first bananas to arrive in Africa were plantains brought to the east coast of Africa across the Indian Ocean by 1000 BC, prior, in other words, to the settlement of Madagascar by Austronesians…

In this scenario, rapid acceptance and development of plantain cultivation in east Africa may have been facilitated by the indigenous inhabitants’ familiarity with Ensete, which they may have already “semi-cultivated” (but note the caution expressed by Philippson and Bahuchet). Indeed, Rossel has suggested that “the importance of the use of Ensete for technical purposes (fiber production) in eastern Africa, combined with the fact that Musa names in many cases borrowed from Ensete, leads [one] to think that an early success of Musa depended more on its usefulness for non-food pruposes (fibers, etc)”. From these auspicious beginnings, plantain cultivation and experimentation with propagation of new cultivars may have spread rapidly across the tropical belt of Africa.
- B. J. Lejju et al. 2005

Consistent with the point the present author made earlier elsewhere, about the largest diversity of plantain bananas found in Western Africa. Bananas may have well been introduced initially from southeast Asia, where it initially grew in the wild, something which perhaps was rare in Africa at the time, and then domesticated. As you can see, these bananas arrived in Africa quite early, possibly not long after early domestication took in place in the vicinity of New Guinea, where transition from the wild to domestication was easily facilitated, very likely because it was already available as a wild plant. However, as noted above, Africans took initiative in experimenting with making these plants develop in ways that make them easier to grow on the environments of the continent, more diverse and more abundant, so as to accommodate regional usages according to respective local tastes.

Aside from bananas, other flora which were introduced into Africa across the Indian Ocean, are namely; coconut (Coco nucifera (L.)), colocasia or taro (Colocasia esculenta (L.) Schott), water yams (Dioscorea alata (L.)), sugarcane [probably originated in New Guinea; see Lejju et al. 2005], and perhaps rice. On the faunal end, chickens (Gallus gallus L.) are perhaps one of the notable ancient southeast Asian imports.

Chickens (Gallus gallus L.) are another southeast Asian domesticate that have become ubiquitous in Africa. Until recently a major problem in dating the arrival of chickens in Africa was the difficulty of separating chickens from indigenous fowl on the basis of osteology. Thus, the archaeological evidence is sparse; the earliest skeletal evidence for this species in Africa, as well as the earliest literary reference, dates to the eighteenth dynasty in Egypt (c. 1567-1320 BC), but the first chicken bones south of the Sahara date only to the mid-1st millennium AD, at Jenne-Jeno- Lejju et al. 2005

Other possible chicken bones were uncovered in Machaga Cave on Zanzibar, dating to approx. first millennium BC [per Lejju et al. 2005].

African domesticated plants in Southeast Asia:

Corn variety, according to B. Julius Lejju et al. 2005:

By ~ 4000 years ago:

Pearl millet

Several crops of African origin occur in south Asia, initially associated directly or indirectly with the Harappan civilization. The first occurrence of pearl (bulrush) millet (Pennisetum glaucoma (L.) R. Br.) falls within the Late Harappan period at or a little earlier.

Sorghum and Finger millet

Sorghum (Sorghum bicolor (L.) Moench) was probably introduced at about the same time (Fuller convincingly refutes the arguments for late domestication of sorghum in Africa). This crop alsoreached Korea by 1400 BC. However, a recent re-examination of the archaeobotanical evidence for finger millet (Eleusine Coracana (L.) Gaertn.) in south Asia has shown that claims for the presence of this crop in the mid-3rd millennium BC were based on faulty identifications; the earliest secure dates for this crop in south Asia fall only towards the end of the 2nd millennium BC.

Cow peas and Hyacinth beans

In addition to these cereals, cow peas (Vigna Unguiculata (L.) Wa;[/). A domestic of west or perhaps southern African origin, were definitely present in southern Asia b about 1500 BC and probably several centuries earlier, while hyacinth beans (Lablab purpureus (L.) Sweet), an east African domesticate, reached south Asia by at least as early as 1800 BC.

Thus, in summary, several plant species that were first domesticated in Africa had reached south Asia towards the beginning of the 2nd millennium BC and possibly by about the end of the 3rd millennium BC. Fuller notes that “The general distribution of Lablab, Eleusine, and caudatum Sorghums might all argue for dispersal from coastal regions south of the horn of Africa”, while there is a dearth of evidence for these crops on the Arabian peninsula.

Evidence for African crops in south Asia by the beginning of the 2nd millennium BC does not itself constitute direct evidence for African-southeast Asian connections during this period. However, it does show that Indian Ocean voyaging, with one terminus probably on the east African coast, occurred by this date.


Artifactual indicators of African-Southeast Asian contact by ~ 5000 years ago

Again, according to B. Julius Lejju et al. 2005,

One piece of art factual evidence also demonstrates that the east African coast was engaged in Asian trade during the 3rd millennium BC. Analysis of a pendant found at Tell Asmar, ancient Eshnunna, in Mesopotamia shows that is was made of copal from the “Zanzibar, Madagascar, Mozambique region of East Africa”.

Similarly intriguing is the ethnographic evidence for ancient connections between Africa and Indonesia. A careful review of this evidence indicates that not only is it likely that xylophone was an African introduction to Indonesia, but also, even more surprisingly, the canoes of Lake Victoria share some very detailed and otherwise globally unknown features with those of Java and Madura. Of course, it is very difficult to discern the antiquity of these connections, though Blench argues that the accuracy of the descriptions of the Lake Victoria region found in Ptolemy’s geography indicates that “a regular trade route must have existed between the Lake and the coast, sufficiently well organized to allow the transmission of maritime technology.”

In summary, our reading of the archaeological evidence from Indian Ocean prehistory indicates that bananas could well have been brought to the east African coast in the 3rd millennium BC. However, there is no evidence from the Indian Ocean to support the hypothesis of an introduction in the preceding millennium, apart from the evidence that bananas had been domesticated at an appropriately early date in New Guinea.

____________________________________________________________
*References:

Multiple as noted.